Incidental Mutation 'R4722:Gas8'
ID354543
Institutional Source Beutler Lab
Gene Symbol Gas8
Ensembl Gene ENSMUSG00000040220
Gene Namegrowth arrest specific 8
SynonymsGas11
MMRRC Submission 041987-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R4722 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123518834-123536650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123525635 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 171 (I171N)
Ref Sequence ENSEMBL: ENSMUSP00000148576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093043] [ENSMUST00000127664] [ENSMUST00000212923]
Predicted Effect probably benign
Transcript: ENSMUST00000093043
AA Change: I171N

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090730
Gene: ENSMUSG00000040220
AA Change: I171N

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
coiled coil region 26 105 N/A INTRINSIC
coiled coil region 164 199 N/A INTRINSIC
Pfam:GAS 221 420 1.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212809
Predicted Effect possibly damaging
Transcript: ENSMUST00000212923
AA Change: I171N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene includes 11 exons spanning 25 kb and maps to a region of chromosome 16 that is sometimes deleted in breast and prostrate cancer. The second intron contains an apparently intronless gene, C16orf3, that is transcribed in the opposite orientation. This gene is a putative tumor suppressor gene. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, severe hydrocephaly, situs inversus with levocardia and abnormal cilia morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G T 12: 55,061,137 D92E probably benign Het
Abca17 A G 17: 24,265,429 F1620L probably damaging Het
Abcf1 T C 17: 35,958,041 probably benign Het
Adtrp T C 13: 41,767,347 H248R probably benign Het
Aldh1b1 T G 4: 45,803,472 F337V probably damaging Het
Amz2 C T 11: 109,434,631 L272F probably damaging Het
Asic2 A T 11: 81,968,183 M1K probably null Het
Avpr1a T A 10: 122,449,001 V66E possibly damaging Het
AW554918 C A 18: 25,174,715 Y28* probably null Het
Ccdc130 A T 8: 84,258,810 C277S probably benign Het
Cdc25b C T 2: 131,193,351 P343L probably damaging Het
Chd7 T A 4: 8,822,445 I846K probably damaging Het
Dnajc13 A T 9: 104,213,818 M688K probably benign Het
Dock2 T A 11: 34,695,471 I505F probably damaging Het
Dpy19l4 A G 4: 11,290,521 V290A possibly damaging Het
Dtl G T 1: 191,556,841 Q254K possibly damaging Het
Enpp2 T G 15: 54,887,589 K265T probably damaging Het
Epm2aip1 TGTCGCCG TG 9: 111,272,084 probably benign Het
Fam133b T A 5: 3,543,949 probably null Het
Fuom A G 7: 140,099,567 probably benign Het
Fut9 T C 4: 25,799,734 probably benign Het
Gipc3 T G 10: 81,341,295 D147A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5591 T C 7: 38,519,148 K767R probably damaging Het
Kctd8 G A 5: 69,341,201 P34L possibly damaging Het
Kmt2b G A 7: 30,583,202 R403C probably damaging Het
Krt84 A T 15: 101,528,411 I396N probably damaging Het
Lrrk2 C A 15: 91,688,901 F217L probably damaging Het
Med27 T A 2: 29,524,435 D290E probably damaging Het
Mical3 T C 6: 121,038,525 Q184R probably benign Het
Mlxip A T 5: 123,447,202 K591M probably benign Het
Mutyh T A 4: 116,816,872 L233H probably damaging Het
Naip6 G T 13: 100,307,072 H253N possibly damaging Het
Nynrin A G 14: 55,854,395 E56G probably damaging Het
Oip5 C T 2: 119,613,011 probably null Het
Olfr1199 T G 2: 88,756,012 H221P possibly damaging Het
Olfr1211 T C 2: 88,929,980 I112V possibly damaging Het
Olfr1335 T C 4: 118,808,949 N305S probably damaging Het
Olfr17 T A 7: 107,097,570 I35N possibly damaging Het
Olfr485 T A 7: 108,159,238 I212F probably benign Het
Oxr1 T C 15: 41,813,649 S132P probably damaging Het
Pcdhac1 C T 18: 37,091,880 T582I probably damaging Het
Prl7a2 A G 13: 27,660,875 I176T probably damaging Het
Rabgap1l T C 1: 160,342,164 T30A possibly damaging Het
Rapgef2 A G 3: 79,069,173 M1294T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rnmt T A 18: 68,305,881 N20K probably damaging Het
Scn7a T A 2: 66,700,884 T550S possibly damaging Het
Shank1 T A 7: 44,313,214 Y117* probably null Het
Skint5 T A 4: 113,893,855 K331I unknown Het
Slc5a1 A G 5: 33,146,711 Y290C possibly damaging Het
Slfn14 T C 11: 83,283,418 E249G probably benign Het
Smarcal1 T C 1: 72,611,337 S544P probably damaging Het
St6galnac3 A T 3: 153,411,529 Y186N probably damaging Het
Tbc1d1 T C 5: 64,263,557 F346S probably damaging Het
Tdrd5 A T 1: 156,302,375 I75K probably benign Het
Tnrc6a T C 7: 123,192,090 M1737T possibly damaging Het
Toe1 A T 4: 116,805,200 Y283N probably damaging Het
Tubal3 G T 13: 3,928,185 G34C probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn1r212 T C 13: 22,883,908 Y85C probably damaging Het
Zdhhc4 A G 5: 143,321,781 S162P probably damaging Het
Zfp712 A G 13: 67,042,113 S117P probably benign Het
Zic4 G T 9: 91,379,204 G164C probably damaging Het
Other mutations in Gas8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Gas8 UTSW 8 123524106 missense probably damaging 1.00
R1552:Gas8 UTSW 8 123520646 missense probably benign 0.00
R2068:Gas8 UTSW 8 123526537 missense probably damaging 0.96
R4840:Gas8 UTSW 8 123531014 missense probably benign 0.25
R5424:Gas8 UTSW 8 123526512 missense possibly damaging 0.58
R6511:Gas8 UTSW 8 123524157 missense probably benign 0.00
R6520:Gas8 UTSW 8 123526474 missense probably benign 0.03
R7318:Gas8 UTSW 8 123530968 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGCCGTGTTATTCTGGGC -3'
(R):5'- CCTGCTGGCTTCTGAAATAGTC -3'

Sequencing Primer
(F):5'- TTTCCAATGCTATACCAAAAGTCC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2015-10-21