Incidental Mutation 'R4722:Abca17'
ID354565
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 041987-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R4722 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24265429 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1620 (F1620L)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably damaging
Transcript: ENSMUST00000039324
AA Change: F1620L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: F1620L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121226
AA Change: F1620L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: F1620L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik G T 12: 55,061,137 D92E probably benign Het
Abcf1 T C 17: 35,958,041 probably benign Het
Adtrp T C 13: 41,767,347 H248R probably benign Het
Aldh1b1 T G 4: 45,803,472 F337V probably damaging Het
Amz2 C T 11: 109,434,631 L272F probably damaging Het
Asic2 A T 11: 81,968,183 M1K probably null Het
Avpr1a T A 10: 122,449,001 V66E possibly damaging Het
AW554918 C A 18: 25,174,715 Y28* probably null Het
Ccdc130 A T 8: 84,258,810 C277S probably benign Het
Cdc25b C T 2: 131,193,351 P343L probably damaging Het
Chd7 T A 4: 8,822,445 I846K probably damaging Het
Dnajc13 A T 9: 104,213,818 M688K probably benign Het
Dock2 T A 11: 34,695,471 I505F probably damaging Het
Dpy19l4 A G 4: 11,290,521 V290A possibly damaging Het
Dtl G T 1: 191,556,841 Q254K possibly damaging Het
Enpp2 T G 15: 54,887,589 K265T probably damaging Het
Epm2aip1 TGTCGCCG TG 9: 111,272,084 probably benign Het
Fam133b T A 5: 3,543,949 probably null Het
Fuom A G 7: 140,099,567 probably benign Het
Fut9 T C 4: 25,799,734 probably benign Het
Gas8 T A 8: 123,525,635 I171N possibly damaging Het
Gipc3 T G 10: 81,341,295 D147A probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm5591 T C 7: 38,519,148 K767R probably damaging Het
Kctd8 G A 5: 69,341,201 P34L possibly damaging Het
Kmt2b G A 7: 30,583,202 R403C probably damaging Het
Krt84 A T 15: 101,528,411 I396N probably damaging Het
Lrrk2 C A 15: 91,688,901 F217L probably damaging Het
Med27 T A 2: 29,524,435 D290E probably damaging Het
Mical3 T C 6: 121,038,525 Q184R probably benign Het
Mlxip A T 5: 123,447,202 K591M probably benign Het
Mutyh T A 4: 116,816,872 L233H probably damaging Het
Naip6 G T 13: 100,307,072 H253N possibly damaging Het
Nynrin A G 14: 55,854,395 E56G probably damaging Het
Oip5 C T 2: 119,613,011 probably null Het
Olfr1199 T G 2: 88,756,012 H221P possibly damaging Het
Olfr1211 T C 2: 88,929,980 I112V possibly damaging Het
Olfr1335 T C 4: 118,808,949 N305S probably damaging Het
Olfr17 T A 7: 107,097,570 I35N possibly damaging Het
Olfr485 T A 7: 108,159,238 I212F probably benign Het
Oxr1 T C 15: 41,813,649 S132P probably damaging Het
Pcdhac1 C T 18: 37,091,880 T582I probably damaging Het
Prl7a2 A G 13: 27,660,875 I176T probably damaging Het
Rabgap1l T C 1: 160,342,164 T30A possibly damaging Het
Rapgef2 A G 3: 79,069,173 M1294T probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rnmt T A 18: 68,305,881 N20K probably damaging Het
Scn7a T A 2: 66,700,884 T550S possibly damaging Het
Shank1 T A 7: 44,313,214 Y117* probably null Het
Skint5 T A 4: 113,893,855 K331I unknown Het
Slc5a1 A G 5: 33,146,711 Y290C possibly damaging Het
Slfn14 T C 11: 83,283,418 E249G probably benign Het
Smarcal1 T C 1: 72,611,337 S544P probably damaging Het
St6galnac3 A T 3: 153,411,529 Y186N probably damaging Het
Tbc1d1 T C 5: 64,263,557 F346S probably damaging Het
Tdrd5 A T 1: 156,302,375 I75K probably benign Het
Tnrc6a T C 7: 123,192,090 M1737T possibly damaging Het
Toe1 A T 4: 116,805,200 Y283N probably damaging Het
Tubal3 G T 13: 3,928,185 G34C probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn1r212 T C 13: 22,883,908 Y85C probably damaging Het
Zdhhc4 A G 5: 143,321,781 S162P probably damaging Het
Zfp712 A G 13: 67,042,113 S117P probably benign Het
Zic4 G T 9: 91,379,204 G164C probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGGCCAGGCAGGTAATATTG -3'
(R):5'- TTCCCCAGTATGGAGGAGTG -3'

Sequencing Primer
(F):5'- CCAGGCAGGTAATATTGAAGCATG -3'
(R):5'- AGTGTGAAGCCTTATGTACCAG -3'
Posted On2015-10-21