Incidental Mutation 'R4723:Arid1b'
ID354632
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
MMRRC Submission 041959-MU
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4723 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 5337290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1673 (I1673L)
Ref Sequence ENSEMBL: ENSMUSP00000156119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably benign
Transcript: ENSMUST00000092723
AA Change: I1620L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: I1620L

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115797
AA Change: I1621L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: I1621L

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115799
AA Change: I1139L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: I1139L

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232180
AA Change: I1673L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 94% (77/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik A T 8: 13,735,937 N69I probably damaging Het
Adgrv1 T C 13: 81,433,525 D4800G probably benign Het
Akna T C 4: 63,387,032 D499G probably benign Het
Bcr T A 10: 75,175,329 M24K probably benign Het
Bsn A G 9: 108,112,655 V1966A probably benign Het
Ccdc39 T C 3: 33,813,078 N928S possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc6 G A 11: 98,908,831 probably null Het
Cmtm1 C T 8: 104,293,675 A371T probably damaging Het
Cmtm7 A C 9: 114,763,391 V46G possibly damaging Het
Cmtr1 A G 17: 29,687,157 probably null Het
Col5a3 T C 9: 20,809,591 H149R unknown Het
Coro7 T G 16: 4,631,994 Q634P probably benign Het
Crym A G 7: 120,201,075 probably null Het
Csmd3 A T 15: 47,669,160 F2546L probably benign Het
Dmap1 T C 4: 117,676,039 T273A probably benign Het
Dnah1 T C 14: 31,272,942 Y2786C probably damaging Het
Echs1 A C 7: 140,110,648 probably benign Het
Edem3 T A 1: 151,804,698 F525I possibly damaging Het
Exosc3 T C 4: 45,319,642 I127V probably benign Het
Fam193a A G 5: 34,420,786 D208G probably benign Het
Farp2 T C 1: 93,580,899 V773A probably benign Het
Gas6 A G 8: 13,466,848 V550A probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2423 A G 13: 13,232,376 noncoding transcript Het
Grin1 T C 2: 25,294,470 S911G probably benign Het
Hkdc1 T C 10: 62,400,354 I470V probably benign Het
Hsdl2 T A 4: 59,593,270 probably benign Het
Iars2 A G 1: 185,315,979 Y519H probably damaging Het
Ikbkb A T 8: 22,669,607 M455K probably benign Het
Keap1 G T 9: 21,231,410 H516Q probably benign Het
Klk1b27 A T 7: 44,056,532 I220F probably damaging Het
Knop1 G A 7: 118,855,864 probably benign Het
Lhcgr T C 17: 88,742,602 T499A probably benign Het
Lrch3 A T 16: 32,988,484 probably null Het
Lrrc2 G A 9: 110,970,160 probably null Het
Lrrk2 T C 15: 91,764,759 L1652P probably damaging Het
Mbl1 T C 14: 41,154,558 V71A possibly damaging Het
Med8 T A 4: 118,411,801 M1K probably null Het
Mfsd2b A G 12: 4,868,992 L88P probably benign Het
Mkrn2 T A 6: 115,611,850 C185S probably damaging Het
Myo1d A G 11: 80,779,841 probably benign Het
Napg T G 18: 62,992,492 probably null Het
Ncor1 A G 11: 62,378,612 M253T probably benign Het
Oas3 T C 5: 120,766,256 T518A unknown Het
Obox3-ps8 A G 17: 36,453,144 noncoding transcript Het
Olfr519 A T 7: 108,893,821 F195L probably benign Het
Olfr656 T C 7: 104,618,489 V270A possibly damaging Het
Olfr71 T C 4: 43,705,785 K261R probably damaging Het
Opn5 A T 17: 42,607,200 M57K probably damaging Het
Pde2a C G 7: 101,494,618 P148R possibly damaging Het
Prss56 C T 1: 87,185,337 L158F possibly damaging Het
Psmg3 G A 5: 139,826,370 probably benign Het
Rnase9 C T 14: 51,039,444 G26R probably damaging Het
Skint4 T C 4: 112,118,236 V131A possibly damaging Het
Slc10a4 T A 5: 73,012,055 V341E probably damaging Het
Slc16a14 T C 1: 84,913,020 Y188C probably damaging Het
Slc7a1 G T 5: 148,335,440 P476T probably damaging Het
Smchd1 A T 17: 71,436,747 C474* probably null Het
Smurf1 A T 5: 144,893,184 D336E probably damaging Het
Sox30 G A 11: 45,984,765 S448N probably benign Het
Spag11a G A 8: 19,159,382 V63I possibly damaging Het
Sprr1b T G 3: 92,437,293 K92T probably damaging Het
Stam2 T C 2: 52,720,950 Y20C probably benign Het
Sult2b1 T A 7: 45,742,065 Y97F probably damaging Het
Tecpr2 C T 12: 110,932,976 P593S probably benign Het
Tek T C 4: 94,799,160 V170A possibly damaging Het
Tiam2 A G 17: 3,450,317 Y891C probably benign Het
Tmem220 A G 11: 67,029,993 T75A possibly damaging Het
Traf3 T G 12: 111,262,036 D560E probably damaging Het
Txlnb A G 10: 17,799,267 H56R probably benign Het
Vmn2r98 A T 17: 19,066,340 N367Y probably benign Het
Vnn3 A G 10: 23,851,691 I36M possibly damaging Het
Zbtb7a G A 10: 81,144,440 R156H probably damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCAAGTCTCCCTTCCTGC -3'
(R):5'- TTGCACCTCAGAGGATCATTTAG -3'

Sequencing Primer
(F):5'- TTCCTGCCCACCATGAAGATG -3'
(R):5'- CACCTCAGAGGATCATTTAGATTCAG -3'
Posted On2015-10-21