Incidental Mutation 'R4724:Cp'
ID354645
Institutional Source Beutler Lab
Gene Symbol Cp
Ensembl Gene ENSMUSG00000003617
Gene Nameceruloplasmin
SynonymsD3Ertd555e
MMRRC Submission 041988-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4724 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19957054-20009145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19972647 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 413 (T413K)
Ref Sequence ENSEMBL: ENSMUSP00000088857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000091309] [ENSMUST00000108325] [ENSMUST00000108328] [ENSMUST00000108329]
Predicted Effect probably benign
Transcript: ENSMUST00000003714
AA Change: T413K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617
AA Change: T413K

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091309
AA Change: T413K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000088857
Gene: ENSMUSG00000003617
AA Change: T413K

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 7.7e-8 PFAM
Pfam:Cu-oxidase 220 357 1.1e-11 PFAM
Pfam:Cu-oxidase_2 280 357 2e-7 PFAM
Pfam:Cu-oxidase_3 444 557 4.6e-7 PFAM
Blast:FA58C 599 674 2e-6 BLAST
Pfam:Cu-oxidase_3 790 898 3.4e-9 PFAM
Pfam:Cu-oxidase_2 928 1055 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108325
AA Change: T413K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103961
Gene: ENSMUSG00000003617
AA Change: T413K

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 4.9e-8 PFAM
Pfam:Cu-oxidase 220 357 9.3e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 2e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.2e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108328
AA Change: T413K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617
AA Change: T413K

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108329
AA Change: T413K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617
AA Change: T413K

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174803
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a copper-containing glycoprotein found soluble in the serum and GPI-anchored in other tissues. It oxidizes Fe(II) to Fe(III) and is proposed to play an important role in iron homeostasis. In humans mutations of this gene cause aceruloplasminemia, which is characterized by retinal degeneration, diabetes, anemia and neurological symptoms. In mouse deficiency of this gene in combination with a deficiency of its homolog hephaestin causes retinal degeneration and serves as a pathophysiological model for aceruloplasminemia and age-related macular degeneration. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit progressive accumulation of stored iron in the liver, spleen, cerebellum, and brainstem, mild iron deficiency anemia, and impaired motor coordination associated with loss of brainstem dopaminergic neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 90,053,541 Q34E probably damaging Het
4933434E20Rik A T 3: 90,053,542 Q34L probably damaging Het
4933434E20Rik G T 3: 90,053,583 V48F probably damaging Het
8430408G22Rik T A 6: 116,652,135 C146* probably null Het
Abra T C 15: 41,865,906 D366G probably damaging Het
Acvr2a T C 2: 48,870,435 S68P probably damaging Het
Adam28 T A 14: 68,626,877 R492S probably damaging Het
Adamts1 T A 16: 85,802,505 E69V probably benign Het
Adgra1 A T 7: 139,875,589 M378L probably benign Het
Adgra2 T A 8: 27,098,822 N101K possibly damaging Het
Adhfe1 T A 1: 9,576,250 F449L probably damaging Het
Akap6 T A 12: 52,795,885 S5R possibly damaging Het
Akap9 G A 5: 4,055,339 R2883Q probably benign Het
Ank3 T A 10: 69,706,858 I16N probably benign Het
Api5 A T 2: 94,423,471 F296I possibly damaging Het
Ceacam14 G T 7: 17,814,050 probably null Het
Cep295 C T 9: 15,330,832 G1768S probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Ctdsp2 T G 10: 126,993,069 V104G probably damaging Het
Ctrc T A 4: 141,846,296 probably null Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dctn1 T A 6: 83,189,938 M257K possibly damaging Het
Dlgap5 C T 14: 47,401,520 probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Exoc8 A G 8: 124,897,250 V126A probably benign Het
Fam185a T A 5: 21,455,787 S267T probably damaging Het
Fhod1 T C 8: 105,337,861 probably benign Het
Fn1 T C 1: 71,648,148 probably null Het
Gadl1 A T 9: 115,954,617 T214S possibly damaging Het
Gem G T 4: 11,706,074 R54L probably damaging Het
Ghr A G 15: 3,325,940 V287A probably benign Het
Gm3642 G A 14: 6,833,344 T215I probably benign Het
Grip1 T A 10: 120,038,683 I732K probably benign Het
Gtpbp2 A T 17: 46,167,221 probably null Het
Heatr6 C T 11: 83,779,548 R976* probably null Het
Hipk2 T A 6: 38,698,392 T1084S probably benign Het
Hmcn1 T C 1: 150,694,833 probably null Het
Hspg2 T A 4: 137,522,127 M1328K probably damaging Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ighv1-64 A G 12: 115,507,846 V17A probably benign Het
Iqgap2 G T 13: 95,635,497 N1391K possibly damaging Het
Irf7 A T 7: 141,264,735 L148Q possibly damaging Het
Kat6b G A 14: 21,660,962 R768K probably benign Het
Lepr G A 4: 101,765,365 W447* probably null Het
Letmd1 A G 15: 100,469,738 Y59C probably damaging Het
Lingo4 A T 3: 94,402,876 K374* probably null Het
Loxl4 G T 19: 42,608,346 D62E probably benign Het
Lrfn2 A G 17: 49,070,434 D181G probably damaging Het
Lrrc71 A T 3: 87,739,174 F526L probably damaging Het
Ltbp1 A T 17: 75,313,008 M711L probably damaging Het
Mcm7 A T 5: 138,169,125 D78E probably damaging Het
Mdh1 T C 11: 21,562,957 N136D probably damaging Het
Meltf T A 16: 31,892,505 N515K probably benign Het
Mis18bp1 T A 12: 65,158,739 T220S probably benign Het
Mtss1 C T 15: 59,081,518 V4M probably damaging Het
Nacc2 A T 2: 26,090,173 F84I probably damaging Het
Nedd9 A G 13: 41,316,597 V360A possibly damaging Het
Nek11 T A 9: 105,392,970 I18F possibly damaging Het
Nkd2 C T 13: 73,847,005 V13M probably damaging Het
Nkx6-3 A G 8: 23,156,269 I152V probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1 A T 11: 73,395,155 I289N probably damaging Het
Olfr1352 A G 10: 78,984,522 H244R probably damaging Het
Olfr1434 T C 19: 12,283,096 L16P probably damaging Het
Olfr215 T C 6: 116,582,937 N3S probably damaging Het
Olfr494 T A 7: 108,367,998 F169L probably benign Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Oprm1 A T 10: 6,758,656 R16* probably null Het
Ostf1 G A 19: 18,593,867 P62L probably damaging Het
Pcdha2 A T 18: 36,940,515 T400S possibly damaging Het
Pcdha5 A T 18: 36,961,496 T353S possibly damaging Het
Pelo A G 13: 115,088,735 F318S probably damaging Het
Polr2f T C 15: 79,146,069 V36A probably benign Het
Ppan G A 9: 20,888,510 R41H probably benign Het
Ppp1r21 C T 17: 88,555,591 R253* probably null Het
Prf1 T A 10: 61,303,708 W482R probably damaging Het
Ralgapa2 T C 2: 146,345,533 T1397A possibly damaging Het
Rev3l T A 10: 39,846,806 Y2598* probably null Het
Scaf11 G T 15: 96,414,848 D1437E probably benign Het
Sec23a C T 12: 58,978,506 G510R probably damaging Het
Sel1l2 A G 2: 140,240,927 M597T probably damaging Het
Slc11a2 A T 15: 100,406,338 S160T possibly damaging Het
Slc18a1 A T 8: 69,073,649 L129* probably null Het
Smg8 A C 11: 87,086,221 L178R probably benign Het
Sp4 T C 12: 118,261,809 T607A probably benign Het
Ssbp2 A G 13: 91,688,814 D266G possibly damaging Het
Sstr3 A T 15: 78,539,697 Y283* probably null Het
Stk32b C T 5: 37,454,934 probably null Het
Svep1 T C 4: 58,070,752 T2345A possibly damaging Het
Synpo2 A G 3: 123,114,291 S459P probably damaging Het
Sytl2 A G 7: 90,348,792 M1V probably null Het
Tas2r102 T A 6: 132,762,557 W143R probably damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tlr2 A T 3: 83,838,185 I197N probably damaging Het
Tmem101 A G 11: 102,153,443 I206T probably benign Het
Tmem108 A G 9: 103,499,489 S254P possibly damaging Het
Tmem198b T C 10: 128,801,481 Q263R probably damaging Het
Vangl1 T C 3: 102,184,554 D72G probably damaging Het
Vmn1r4 T A 6: 56,957,364 D284E probably benign Het
Vmn2r31 G A 7: 7,384,758 L605F possibly damaging Het
Zfand4 T C 6: 116,273,819 V70A probably damaging Het
Zfp54 A G 17: 21,433,403 E53G probably damaging Het
Zfp541 A T 7: 16,081,687 I805F probably damaging Het
Zfp976 T C 7: 42,613,033 H460R possibly damaging Het
Other mutations in Cp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Cp APN 3 19985662 missense possibly damaging 0.95
IGL00923:Cp APN 3 19970001 missense probably damaging 1.00
IGL01302:Cp APN 3 19966367 missense probably damaging 0.99
IGL01407:Cp APN 3 19977205 missense possibly damaging 0.79
IGL01505:Cp APN 3 19977192 missense possibly damaging 0.83
IGL01677:Cp APN 3 19966434 missense probably damaging 1.00
IGL02013:Cp APN 3 19988049 missense probably damaging 1.00
IGL02114:Cp APN 3 19966347 missense probably benign 0.16
IGL02950:Cp APN 3 19988001 missense probably damaging 0.99
IGL03330:Cp APN 3 19966435 missense probably damaging 1.00
iron10 UTSW 3 19989148 unclassified probably benign
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0008:Cp UTSW 3 19968123 missense probably damaging 1.00
R0320:Cp UTSW 3 19974848 splice site probably benign
R0632:Cp UTSW 3 19971082 missense probably null 0.98
R1103:Cp UTSW 3 19981985 missense possibly damaging 0.82
R1137:Cp UTSW 3 19978952 missense probably benign 0.04
R1199:Cp UTSW 3 19977152 missense probably damaging 1.00
R1523:Cp UTSW 3 19989065 missense probably benign 0.00
R1629:Cp UTSW 3 19966450 critical splice donor site probably null
R1678:Cp UTSW 3 19972717 missense probably damaging 0.99
R1733:Cp UTSW 3 19968219 splice site probably benign
R1779:Cp UTSW 3 19957385 missense possibly damaging 0.91
R1816:Cp UTSW 3 19968220 splice site probably benign
R1990:Cp UTSW 3 19979013 missense probably damaging 1.00
R2014:Cp UTSW 3 19987434 missense probably benign 0.00
R2179:Cp UTSW 3 19987987 missense probably damaging 1.00
R2249:Cp UTSW 3 19987570 missense probably damaging 1.00
R3440:Cp UTSW 3 19974957 missense probably benign 0.02
R3441:Cp UTSW 3 19974957 missense probably benign 0.02
R3886:Cp UTSW 3 19989111 missense probably damaging 1.00
R3937:Cp UTSW 3 19971034 missense probably damaging 1.00
R4387:Cp UTSW 3 19977202 missense probably damaging 1.00
R4412:Cp UTSW 3 19966353 missense probably damaging 1.00
R4413:Cp UTSW 3 19966353 missense probably damaging 1.00
R4514:Cp UTSW 3 19988013 missense probably damaging 0.99
R4578:Cp UTSW 3 19973888 missense probably damaging 1.00
R4579:Cp UTSW 3 19957435 splice site probably null
R4694:Cp UTSW 3 19974885 missense probably benign 0.07
R4910:Cp UTSW 3 19989224 unclassified probably benign
R4960:Cp UTSW 3 19973797 missense probably damaging 0.96
R5043:Cp UTSW 3 19973917 missense probably benign 0.00
R5063:Cp UTSW 3 19989215 missense probably benign 0.27
R5294:Cp UTSW 3 19966316 missense probably benign 0.00
R5382:Cp UTSW 3 19978925 missense probably damaging 1.00
R5404:Cp UTSW 3 19989128 missense possibly damaging 0.92
R5569:Cp UTSW 3 19978877 missense probably damaging 1.00
R5789:Cp UTSW 3 19957290 missense probably benign
R5943:Cp UTSW 3 19964306 missense probably benign 0.11
R6492:Cp UTSW 3 19982022 missense probably benign 0.20
R6540:Cp UTSW 3 19964529 critical splice donor site probably null
R7007:Cp UTSW 3 19969973 missense probably damaging 0.97
R7126:Cp UTSW 3 19980624 missense probably damaging 1.00
R7136:Cp UTSW 3 19985658 nonsense probably null
R7212:Cp UTSW 3 19974966 missense probably damaging 1.00
R7269:Cp UTSW 3 19983477 missense probably damaging 1.00
R7316:Cp UTSW 3 19972752 missense probably damaging 1.00
R7336:Cp UTSW 3 19964532 splice site probably null
R7361:Cp UTSW 3 19964306 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGGAGTACCTAAACCTTAACCAGG -3'
(R):5'- CATGCTACAGGTCCTGACAC -3'

Sequencing Primer
(F):5'- CTGAGCAAATGAACATGGGTATCAC -3'
(R):5'- ATGCTACAGGTCCTGACACTTTGG -3'
Posted On2015-10-21