Incidental Mutation 'R4724:Hspg2'
ID354662
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Nameperlecan (heparan sulfate proteoglycan 2)
SynonymsPlc, Pcn, per
MMRRC Submission 041988-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4724 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137468769-137570630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 137522127 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1328 (M1328K)
Ref Sequence ENSEMBL: ENSMUSP00000030547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
Predicted Effect probably damaging
Transcript: ENSMUST00000030547
AA Change: M1328K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: M1328K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171332
AA Change: M1328K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: M1328K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik C G 3: 90,053,541 Q34E probably damaging Het
4933434E20Rik A T 3: 90,053,542 Q34L probably damaging Het
4933434E20Rik G T 3: 90,053,583 V48F probably damaging Het
8430408G22Rik T A 6: 116,652,135 C146* probably null Het
Abra T C 15: 41,865,906 D366G probably damaging Het
Acvr2a T C 2: 48,870,435 S68P probably damaging Het
Adam28 T A 14: 68,626,877 R492S probably damaging Het
Adamts1 T A 16: 85,802,505 E69V probably benign Het
Adgra1 A T 7: 139,875,589 M378L probably benign Het
Adgra2 T A 8: 27,098,822 N101K possibly damaging Het
Adhfe1 T A 1: 9,576,250 F449L probably damaging Het
Akap6 T A 12: 52,795,885 S5R possibly damaging Het
Akap9 G A 5: 4,055,339 R2883Q probably benign Het
Ank3 T A 10: 69,706,858 I16N probably benign Het
Api5 A T 2: 94,423,471 F296I possibly damaging Het
Ceacam14 G T 7: 17,814,050 probably null Het
Cep295 C T 9: 15,330,832 G1768S probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cp C A 3: 19,972,647 T413K probably benign Het
Ctdsp2 T G 10: 126,993,069 V104G probably damaging Het
Ctrc T A 4: 141,846,296 probably null Het
Dbt T C 3: 116,533,296 I98T probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dctn1 T A 6: 83,189,938 M257K possibly damaging Het
Dlgap5 C T 14: 47,401,520 probably null Het
Drd3 G T 16: 43,822,801 E467* probably null Het
Exoc8 A G 8: 124,897,250 V126A probably benign Het
Fam185a T A 5: 21,455,787 S267T probably damaging Het
Fhod1 T C 8: 105,337,861 probably benign Het
Fn1 T C 1: 71,648,148 probably null Het
Gadl1 A T 9: 115,954,617 T214S possibly damaging Het
Gem G T 4: 11,706,074 R54L probably damaging Het
Ghr A G 15: 3,325,940 V287A probably benign Het
Gm3642 G A 14: 6,833,344 T215I probably benign Het
Grip1 T A 10: 120,038,683 I732K probably benign Het
Gtpbp2 A T 17: 46,167,221 probably null Het
Heatr6 C T 11: 83,779,548 R976* probably null Het
Hipk2 T A 6: 38,698,392 T1084S probably benign Het
Hmcn1 T C 1: 150,694,833 probably null Het
Ifna4 C A 4: 88,842,282 T141K probably benign Het
Ighv1-64 A G 12: 115,507,846 V17A probably benign Het
Iqgap2 G T 13: 95,635,497 N1391K possibly damaging Het
Irf7 A T 7: 141,264,735 L148Q possibly damaging Het
Kat6b G A 14: 21,660,962 R768K probably benign Het
Lepr G A 4: 101,765,365 W447* probably null Het
Letmd1 A G 15: 100,469,738 Y59C probably damaging Het
Lingo4 A T 3: 94,402,876 K374* probably null Het
Loxl4 G T 19: 42,608,346 D62E probably benign Het
Lrfn2 A G 17: 49,070,434 D181G probably damaging Het
Lrrc71 A T 3: 87,739,174 F526L probably damaging Het
Ltbp1 A T 17: 75,313,008 M711L probably damaging Het
Mcm7 A T 5: 138,169,125 D78E probably damaging Het
Mdh1 T C 11: 21,562,957 N136D probably damaging Het
Meltf T A 16: 31,892,505 N515K probably benign Het
Mis18bp1 T A 12: 65,158,739 T220S probably benign Het
Mtss1 C T 15: 59,081,518 V4M probably damaging Het
Nacc2 A T 2: 26,090,173 F84I probably damaging Het
Nedd9 A G 13: 41,316,597 V360A possibly damaging Het
Nek11 T A 9: 105,392,970 I18F possibly damaging Het
Nkd2 C T 13: 73,847,005 V13M probably damaging Het
Nkx6-3 A G 8: 23,156,269 I152V probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1 A T 11: 73,395,155 I289N probably damaging Het
Olfr1352 A G 10: 78,984,522 H244R probably damaging Het
Olfr1434 T C 19: 12,283,096 L16P probably damaging Het
Olfr215 T C 6: 116,582,937 N3S probably damaging Het
Olfr494 T A 7: 108,367,998 F169L probably benign Het
Olfr66 A G 7: 103,881,649 V198A probably benign Het
Oprm1 A T 10: 6,758,656 R16* probably null Het
Ostf1 G A 19: 18,593,867 P62L probably damaging Het
Pcdha2 A T 18: 36,940,515 T400S possibly damaging Het
Pcdha5 A T 18: 36,961,496 T353S possibly damaging Het
Pelo A G 13: 115,088,735 F318S probably damaging Het
Polr2f T C 15: 79,146,069 V36A probably benign Het
Ppan G A 9: 20,888,510 R41H probably benign Het
Ppp1r21 C T 17: 88,555,591 R253* probably null Het
Prf1 T A 10: 61,303,708 W482R probably damaging Het
Ralgapa2 T C 2: 146,345,533 T1397A possibly damaging Het
Rev3l T A 10: 39,846,806 Y2598* probably null Het
Scaf11 G T 15: 96,414,848 D1437E probably benign Het
Sec23a C T 12: 58,978,506 G510R probably damaging Het
Sel1l2 A G 2: 140,240,927 M597T probably damaging Het
Slc11a2 A T 15: 100,406,338 S160T possibly damaging Het
Slc18a1 A T 8: 69,073,649 L129* probably null Het
Smg8 A C 11: 87,086,221 L178R probably benign Het
Sp4 T C 12: 118,261,809 T607A probably benign Het
Ssbp2 A G 13: 91,688,814 D266G possibly damaging Het
Sstr3 A T 15: 78,539,697 Y283* probably null Het
Stk32b C T 5: 37,454,934 probably null Het
Svep1 T C 4: 58,070,752 T2345A possibly damaging Het
Synpo2 A G 3: 123,114,291 S459P probably damaging Het
Sytl2 A G 7: 90,348,792 M1V probably null Het
Tas2r102 T A 6: 132,762,557 W143R probably damaging Het
Thy1 T C 9: 44,047,348 V129A probably damaging Het
Tlr2 A T 3: 83,838,185 I197N probably damaging Het
Tmem101 A G 11: 102,153,443 I206T probably benign Het
Tmem108 A G 9: 103,499,489 S254P possibly damaging Het
Tmem198b T C 10: 128,801,481 Q263R probably damaging Het
Vangl1 T C 3: 102,184,554 D72G probably damaging Het
Vmn1r4 T A 6: 56,957,364 D284E probably benign Het
Vmn2r31 G A 7: 7,384,758 L605F possibly damaging Het
Zfand4 T C 6: 116,273,819 V70A probably damaging Het
Zfp54 A G 17: 21,433,403 E53G probably damaging Het
Zfp541 A T 7: 16,081,687 I805F probably damaging Het
Zfp976 T C 7: 42,613,033 H460R possibly damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137528820 missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137539195 missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137562201 missense probably benign 0.15
IGL00970:Hspg2 APN 4 137542590 missense probably benign 0.09
IGL01011:Hspg2 APN 4 137559335 missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137546658 missense probably benign 0.11
IGL01333:Hspg2 APN 4 137540314 missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137538489 missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137553817 missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137519706 missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137539183 missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137552803 missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137514773 missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137564926 missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137512671 missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137561926 missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137540073 missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137552254 missense probably benign
IGL02051:Hspg2 APN 4 137568389 unclassified probably benign
IGL02124:Hspg2 APN 4 137518814 splice site probably null
IGL02128:Hspg2 APN 4 137564016 missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137515316 missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137518645 missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137510577 missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137508389 missense probably benign 0.03
IGL02477:Hspg2 APN 4 137544512 splice site probably benign
IGL02514:Hspg2 APN 4 137569576 missense probably benign 0.09
IGL02613:Hspg2 APN 4 137544420 missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137512642 missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137551848 missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137557445 splice site probably benign
IGL02701:Hspg2 APN 4 137557174 missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137555130 missense probably benign 0.00
IGL02985:Hspg2 APN 4 137507803 missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137561825 critical splice donor site probably null
IGL03181:Hspg2 APN 4 137515937 missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137560522 splice site probably benign
PIT4305001:Hspg2 UTSW 4 137550373 missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137519931 missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137542849 missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137562201 missense probably benign 0.15
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137511158 missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137515423 missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137533529 missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137550024 missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137502294 missense probably benign
R0599:Hspg2 UTSW 4 137512401 missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137553280 missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137512349 missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137541440 missense probably benign 0.00
R1403:Hspg2 UTSW 4 137540100 missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137517636 missense probably benign
R1497:Hspg2 UTSW 4 137548096 missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137511241 splice site probably benign
R1625:Hspg2 UTSW 4 137518971 missense probably benign 0.23
R1630:Hspg2 UTSW 4 137518435 missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137533437 nonsense probably null
R1699:Hspg2 UTSW 4 137548012 splice site probably null
R1703:Hspg2 UTSW 4 137559151 missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137514673 missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137520156 missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137518509 missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137545567 missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137565490 missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137542552 missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137564895 missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137568366 missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137559367 missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137520109 missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137517604 missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137522043 missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137549574 missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137555290 missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137565504 splice site probably benign
R3873:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137559314 missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137556657 missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137468911 missense probably benign 0.17
R4355:Hspg2 UTSW 4 137529418 missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4411:Hspg2 UTSW 4 137562224 missense probably benign
R4421:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4592:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137539575 missense possibly damaging 0.80
R4619:Hspg2 UTSW 4 137546573 missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137533730 missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137539645 missense possibly damaging 0.90
R4739:Hspg2 UTSW 4 137570073 unclassified probably benign
R4793:Hspg2 UTSW 4 137529473 missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137565395 missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137541666 missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137542530 missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137508031 missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137511926 missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137543914 missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137528794 splice site probably null
R5529:Hspg2 UTSW 4 137551828 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137520551 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137542825 missense probably benign 0.17
R5546:Hspg2 UTSW 4 137548174 critical splice donor site probably null
R5728:Hspg2 UTSW 4 137542766 missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137561721 missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137553782 missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137540735 missense probably benign
R6164:Hspg2 UTSW 4 137514655 missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137569518 missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137540248 missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137519686 missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137544705 missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137561955 missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137541695 missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137539396 missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137507801 missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137555275 missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137565737 missense probably benign 0.18
R6724:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137551803 missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137508398 missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137540720 missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137519289 missense probably benign 0.45
R6968:Hspg2 UTSW 4 137535156 missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137528890 missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137542269 missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137544366 missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137510652 missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137552116 missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137514719 missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137533561 critical splice donor site probably null
R7238:Hspg2 UTSW 4 137508393 missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137519946 missense probably benign 0.15
R7278:Hspg2 UTSW 4 137551125 missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137529556 missense probably benign 0.00
R7390:Hspg2 UTSW 4 137539179 missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137515664 missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137539403 missense probably benign 0.17
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137550391 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCACGACTGCTAGTAAG -3'
(R):5'- AAGGGTTAGCTTGGTCAGGC -3'

Sequencing Primer
(F):5'- ACTGCTAGTAAGTAGTGGCTGG -3'
(R):5'- TTAGCTTGGTCAGGCACACC -3'
Posted On2015-10-21