Incidental Mutation 'R4689:F5'
ID354751
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Namecoagulation factor V
SynonymsCf-5, Cf5
MMRRC Submission 041940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4689 (G1)
Quality Score119
Status Validated
Chromosome1
Chromosomal Location164151838-164220277 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 164151973 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040] [ENSMUST00000162746]
PDB Structure
Structure of the SNX17 atypical FERM domain bound to the NPxY motif of P-selectin [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000086040
AA Change: V4A
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: V4A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161020
Predicted Effect probably benign
Transcript: ENSMUST00000161152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162102
Predicted Effect probably benign
Transcript: ENSMUST00000162746
SMART Domains Protein: ENSMUSP00000123924
Gene: ENSMUSG00000026580

DomainStartEndE-ValueType
CLECT 30 159 2.89e-16 SMART
EGF 162 195 1.97e-4 SMART
CCP 200 257 1.31e-14 SMART
CCP 262 319 4.02e-15 SMART
CCP 324 381 5.91e-13 SMART
CCP 386 443 1.46e-12 SMART
CCP 448 505 3.9e-13 SMART
CCP 510 567 1.95e-13 SMART
CCP 580 637 1.97e-9 SMART
CCP 642 699 3.9e-13 SMART
transmembrane domain 711 733 N/A INTRINSIC
PDB:4GXB|B 741 768 2e-12 PDB
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 C A 17: 46,324,070 V336L probably benign Het
Acbd4 T C 11: 103,105,368 L165P possibly damaging Het
Adam10 T C 9: 70,765,954 S456P possibly damaging Het
Adgre4 T C 17: 55,802,096 F368L probably damaging Het
Ahcyl1 G T 3: 107,665,518 Y528* probably null Het
Aldh3b3 G A 19: 3,964,516 V84M probably damaging Het
Cdca8 C T 4: 124,931,103 G78E probably damaging Het
Cry2 T C 2: 92,424,554 D152G probably benign Het
Cyp2c67 T C 19: 39,638,588 Y266C probably benign Het
Dkk4 T C 8: 22,625,320 F62S probably benign Het
Dnah12 G A 14: 26,706,839 V207I probably benign Het
Dthd1 T C 5: 62,842,912 C526R probably damaging Het
Dubr A T 16: 50,732,503 noncoding transcript Het
Flcn A C 11: 59,801,044 W260G possibly damaging Het
Fmnl1 G A 11: 103,193,736 probably null Het
Frem2 A T 3: 53,547,635 D2173E probably benign Het
Fstl4 C T 11: 53,068,650 Q173* probably null Het
Gfra3 G A 18: 34,690,587 P381S unknown Het
Gm28308 C A 6: 52,213,311 probably benign Het
Gm8394 T A 10: 85,314,201 noncoding transcript Het
Gm8730 T A 8: 102,865,747 noncoding transcript Het
Gzmd T C 14: 56,131,226 probably null Het
Hexb A G 13: 97,181,092 Y366H probably damaging Het
Hydin A T 8: 110,595,414 H4566L probably benign Het
Ifi213 G A 1: 173,590,420 T142I possibly damaging Het
Kif13b T A 14: 64,773,064 C1271S probably damaging Het
Krtap9-5 G T 11: 99,949,460 C329F unknown Het
Larp1 G T 11: 58,041,613 G207W probably damaging Het
Lfng A G 5: 140,614,439 D368G probably damaging Het
Mbd5 G A 2: 49,258,279 V834I possibly damaging Het
Mterf1b T A 5: 4,197,263 Y301* probably null Het
Myh7b T C 2: 155,630,514 I1305T possibly damaging Het
Myo16 T C 8: 10,438,890 V687A probably damaging Het
Naip2 A T 13: 100,148,812 I1292N probably damaging Het
Nmral1 A G 16: 4,714,558 F130L probably damaging Het
Nos1 A G 5: 117,879,385 N271S probably benign Het
Nrap A G 19: 56,386,026 S23P probably damaging Het
Olfr106-ps A T 17: 37,394,771 N77I probably damaging Het
Olfr1509 T C 14: 52,451,214 I267T probably benign Het
Olfr169 A T 16: 19,566,513 Y123* probably null Het
Olfr800 T C 10: 129,660,316 V170A probably benign Het
Pkdcc C G 17: 83,215,861 C132W probably damaging Het
Plekhg6 G A 6: 125,373,181 L265F probably benign Het
Prkaa1 A G 15: 5,178,696 T473A probably benign Het
Prpf3 G A 3: 95,836,489 Q451* probably null Het
Ptprh T A 7: 4,597,997 D127V possibly damaging Het
Rab36 T C 10: 75,041,933 probably null Het
Rasa1 A T 13: 85,238,163 Y427* probably null Het
Rgs11 T C 17: 26,204,547 probably null Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Shank2 G A 7: 144,420,605 V1087I probably benign Het
Slc39a10 A C 1: 46,836,013 M43R probably benign Het
Slc40a1 T A 1: 45,912,313 Q228L probably benign Het
Slc45a1 A T 4: 150,638,539 L296Q probably benign Het
Stambpl1 A G 19: 34,236,291 T307A probably benign Het
Stt3a T C 9: 36,732,929 T705A possibly damaging Het
Tec G A 5: 72,823,637 probably benign Het
Trp63 A T 16: 25,865,262 T300S possibly damaging Het
Vmn1r235 A G 17: 21,262,361 H316R probably benign Het
Vmn2r1 A G 3: 64,104,653 H645R possibly damaging Het
Wdfy4 A G 14: 33,109,548 I907T possibly damaging Het
Zcchc10 A G 11: 53,327,324 T33A probably benign Het
Zfp318 T A 17: 46,399,634 V761D probably damaging Het
Zfp358 T C 8: 3,496,146 probably null Het
Zfp661 G A 2: 127,577,548 P224L probably damaging Het
Zfp937 T C 2: 150,236,786 M33T probably damaging Het
Zfp955a T C 17: 33,242,066 H364R probably damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164179524 missense probably benign 0.15
IGL00843:F5 APN 1 164211791 missense probably benign 0.00
IGL00904:F5 APN 1 164194009 missense probably benign
IGL00913:F5 APN 1 164204896 missense probably damaging 1.00
IGL01099:F5 APN 1 164194334 missense probably damaging 0.99
IGL01134:F5 APN 1 164191979 missense possibly damaging 0.87
IGL01313:F5 APN 1 164193612 missense probably benign 0.01
IGL01635:F5 APN 1 164207858 missense probably benign 0.00
IGL01697:F5 APN 1 164194052 missense probably benign 0.04
IGL01768:F5 APN 1 164176345 missense probably benign 0.22
IGL01795:F5 APN 1 164194390 missense probably benign 0.00
IGL01835:F5 APN 1 164194368 missense probably benign 0.12
IGL01843:F5 APN 1 164211826 missense probably benign 0.05
IGL01989:F5 APN 1 164176307 missense probably benign 0.39
IGL02036:F5 APN 1 164183002 splice site probably benign
IGL02065:F5 APN 1 164190126 missense probably damaging 1.00
IGL02077:F5 APN 1 164198866 missense probably damaging 1.00
IGL02139:F5 APN 1 164192674 missense possibly damaging 0.89
IGL02210:F5 APN 1 164190141 missense probably benign 0.00
IGL02415:F5 APN 1 164191929 missense probably damaging 1.00
IGL02440:F5 APN 1 164207066 missense possibly damaging 0.79
IGL02471:F5 APN 1 164174291 missense probably damaging 1.00
IGL02535:F5 APN 1 164198733 missense probably damaging 0.98
IGL02537:F5 APN 1 164193117 missense probably benign 0.26
IGL02628:F5 APN 1 164194075 missense probably damaging 0.99
IGL02638:F5 APN 1 164184608 critical splice donor site probably null
IGL02824:F5 APN 1 164194347 missense probably benign 0.00
IGL02977:F5 APN 1 164194021 missense probably damaging 1.00
IGL03028:F5 APN 1 164193000 nonsense probably null
IGL03064:F5 APN 1 164195594 missense probably benign 0.04
IGL03127:F5 APN 1 164193538 missense probably benign 0.45
IGL03131:F5 APN 1 164161819 missense possibly damaging 0.62
IGL03348:F5 APN 1 164194152 missense possibly damaging 0.49
IGL03387:F5 APN 1 164193232 missense probably damaging 1.00
James_dean UTSW 1 164204820 missense probably benign 0.43
R0002:F5 UTSW 1 164201631 missense probably damaging 1.00
R0095:F5 UTSW 1 164191968 nonsense probably null
R0116:F5 UTSW 1 164184914 missense probably benign 0.01
R0359:F5 UTSW 1 164179449 missense probably damaging 1.00
R0426:F5 UTSW 1 164182840 missense probably damaging 0.99
R0452:F5 UTSW 1 164185107 missense probably damaging 0.99
R0457:F5 UTSW 1 164194200 missense probably benign 0.00
R0520:F5 UTSW 1 164209587 missense probably benign 0.15
R0522:F5 UTSW 1 164211763 missense probably damaging 1.00
R0554:F5 UTSW 1 164179449 missense probably damaging 1.00
R0575:F5 UTSW 1 164176244 missense probably damaging 1.00
R0734:F5 UTSW 1 164198917 missense probably damaging 1.00
R0739:F5 UTSW 1 164198917 missense probably damaging 1.00
R1062:F5 UTSW 1 164198917 missense probably damaging 1.00
R1063:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1150:F5 UTSW 1 164198917 missense probably damaging 1.00
R1151:F5 UTSW 1 164198917 missense probably damaging 1.00
R1152:F5 UTSW 1 164198917 missense probably damaging 1.00
R1221:F5 UTSW 1 164161799 missense probably damaging 1.00
R1284:F5 UTSW 1 164198917 missense probably damaging 1.00
R1286:F5 UTSW 1 164198917 missense probably damaging 1.00
R1358:F5 UTSW 1 164198917 missense probably damaging 1.00
R1360:F5 UTSW 1 164198917 missense probably damaging 1.00
R1362:F5 UTSW 1 164198917 missense probably damaging 1.00
R1383:F5 UTSW 1 164198917 missense probably damaging 1.00
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1545:F5 UTSW 1 164208960 nonsense probably null
R1561:F5 UTSW 1 164186903 nonsense probably null
R1623:F5 UTSW 1 164195622 missense probably damaging 1.00
R1662:F5 UTSW 1 164207888 missense probably damaging 1.00
R1673:F5 UTSW 1 164179520 missense probably damaging 1.00
R1689:F5 UTSW 1 164198917 missense probably damaging 1.00
R1705:F5 UTSW 1 164217490 missense possibly damaging 0.92
R1732:F5 UTSW 1 164174150 missense probably damaging 1.00
R1763:F5 UTSW 1 164192535 missense probably benign 0.04
R1774:F5 UTSW 1 164192535 missense probably benign 0.04
R1799:F5 UTSW 1 164193531 missense possibly damaging 0.58
R1800:F5 UTSW 1 164182834 missense probably damaging 1.00
R1842:F5 UTSW 1 164184560 missense probably damaging 0.99
R1915:F5 UTSW 1 164182917 missense probably damaging 0.97
R1926:F5 UTSW 1 164179508 missense probably damaging 1.00
R2025:F5 UTSW 1 164209475 missense probably benign 0.05
R2198:F5 UTSW 1 164207034 missense probably damaging 1.00
R2258:F5 UTSW 1 164192181 missense probably damaging 1.00
R2264:F5 UTSW 1 164194402 missense probably benign 0.32
R2281:F5 UTSW 1 164195720 missense possibly damaging 0.80
R2407:F5 UTSW 1 164211872 missense probably damaging 1.00
R2445:F5 UTSW 1 164190226 missense probably damaging 1.00
R2860:F5 UTSW 1 164184964 missense probably damaging 1.00
R2861:F5 UTSW 1 164184964 missense probably damaging 1.00
R2862:F5 UTSW 1 164184964 missense probably damaging 1.00
R2899:F5 UTSW 1 164186900 missense possibly damaging 0.88
R2910:F5 UTSW 1 164204820 missense probably benign 0.43
R2912:F5 UTSW 1 164193919 missense probably damaging 0.98
R2996:F5 UTSW 1 164182917 missense probably damaging 0.97
R3745:F5 UTSW 1 164186779 missense possibly damaging 0.79
R3901:F5 UTSW 1 164176229 missense probably benign 0.08
R3902:F5 UTSW 1 164176229 missense probably benign 0.08
R4365:F5 UTSW 1 164184950 missense probably damaging 0.98
R4448:F5 UTSW 1 164198899 missense possibly damaging 0.52
R4490:F5 UTSW 1 164217395 missense probably benign 0.40
R4514:F5 UTSW 1 164151997 unclassified probably benign
R4598:F5 UTSW 1 164204797 missense probably benign 0.05
R4608:F5 UTSW 1 164209029 missense probably benign 0.12
R4661:F5 UTSW 1 164184920 missense probably damaging 1.00
R4667:F5 UTSW 1 164174186 missense probably benign 0.00
R4716:F5 UTSW 1 164193919 missense probably damaging 0.98
R4732:F5 UTSW 1 164181657 missense probably damaging 1.00
R4733:F5 UTSW 1 164181657 missense probably damaging 1.00
R4854:F5 UTSW 1 164192146 missense probably damaging 1.00
R4908:F5 UTSW 1 164211820 missense probably damaging 1.00
R4971:F5 UTSW 1 164194186 missense probably benign
R5001:F5 UTSW 1 164195570 missense probably benign 0.00
R5042:F5 UTSW 1 164219451 missense probably damaging 1.00
R5056:F5 UTSW 1 164192032 missense possibly damaging 0.60
R5061:F5 UTSW 1 164194180 missense probably benign 0.00
R5143:F5 UTSW 1 164211828 missense probably damaging 0.98
R5622:F5 UTSW 1 164192565 missense probably benign 0.09
R5626:F5 UTSW 1 164209035 missense probably damaging 0.98
R5658:F5 UTSW 1 164192338 missense probably damaging 0.96
R5702:F5 UTSW 1 164194547 nonsense probably null
R5795:F5 UTSW 1 164152009 missense probably benign 0.09
R5884:F5 UTSW 1 164195646 missense probably benign 0.01
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6151:F5 UTSW 1 164181635 missense probably damaging 1.00
R6151:F5 UTSW 1 164190187 missense probably damaging 1.00
R6345:F5 UTSW 1 164191951 missense probably benign 0.13
R6391:F5 UTSW 1 164193493 missense probably damaging 0.99
R6542:F5 UTSW 1 164194468 missense probably benign 0.32
R6620:F5 UTSW 1 164186806 missense probably damaging 1.00
R6750:F5 UTSW 1 164193507 missense possibly damaging 0.58
R6754:F5 UTSW 1 164193763 missense probably damaging 1.00
R6774:F5 UTSW 1 164186878 missense probably damaging 1.00
R6802:F5 UTSW 1 164179356 missense probably damaging 0.98
R6810:F5 UTSW 1 164186902 missense probably damaging 1.00
R6983:F5 UTSW 1 164194129 missense probably damaging 1.00
R7000:F5 UTSW 1 164179506 missense probably damaging 1.00
R7151:F5 UTSW 1 164201661 missense probably damaging 1.00
X0024:F5 UTSW 1 164192988 missense probably damaging 1.00
Z1088:F5 UTSW 1 164154385 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATTCTCTCTAGTAAATGCCTGTGG -3'
(R):5'- GAAGCCCACCTGGATTTCAC -3'

Sequencing Primer
(F):5'- GGGAGTGACCTCAACAAGCC -3'
(R):5'- ACCTGGATTTCACCCCCAG -3'
Posted On2015-10-21