Incidental Mutation 'R4690:Pomgnt1'
ID354826
Institutional Source Beutler Lab
Gene Symbol Pomgnt1
Ensembl Gene ENSMUSG00000028700
Gene Nameprotein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Synonyms0610016I07Rik, 4930467B06Rik
MMRRC Submission 041941-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4690 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116123840-116159849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116155510 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 401 (D401E)
Ref Sequence ENSEMBL: ENSMUSP00000112911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106494] [ENSMUST00000106496] [ENSMUST00000106498] [ENSMUST00000120083] [ENSMUST00000121052]
Predicted Effect probably damaging
Transcript: ENSMUST00000106494
AA Change: D379E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102103
Gene: ENSMUSG00000028700
AA Change: D379E

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
PDB:2YOQ|C 106 195 6e-10 PDB
Pfam:GNT-I 271 591 3e-52 PFAM
low complexity region 623 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106496
AA Change: D368E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102105
Gene: ENSMUSG00000028700
AA Change: D368E

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOP|C 129 217 5e-10 PDB
Pfam:GNT-I 260 580 2.9e-52 PFAM
low complexity region 612 625 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106498
AA Change: D401E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102107
Gene: ENSMUSG00000028700
AA Change: D401E

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120083
AA Change: D401E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112751
Gene: ENSMUSG00000028700
AA Change: D401E

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
Pfam:ILEI 129 220 8.9e-28 PFAM
Pfam:GNT-I 293 612 1.9e-51 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121052
AA Change: D401E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112911
Gene: ENSMUSG00000028700
AA Change: D401E

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155718
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Surviving homozygous null mice display a mild dystrophy despite a reduced muscle mass and myofiber number, impaired muscle regeneration and low proliferative activity of satellite cells. Mice homozygous for a gene trap allele show reduced fertility and multiple defects in muscle, eye and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,148,880 F436L probably damaging Het
Adam28 G T 14: 68,642,048 Q184K probably benign Het
Adh6a A G 3: 138,326,171 T275A possibly damaging Het
Agap2 A G 10: 127,091,375 D1082G possibly damaging Het
Alox5 A T 6: 116,423,189 V263E probably damaging Het
Arhgef16 C T 4: 154,287,963 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Ccdc188 T A 16: 18,218,295 H111Q probably damaging Het
Cd40 T C 2: 165,069,695 F209S possibly damaging Het
Cfap43 C A 19: 47,747,859 V1398L probably benign Het
Cln3 A T 7: 126,575,393 I286N possibly damaging Het
Col9a1 T C 1: 24,224,706 probably null Het
Cpne9 A G 6: 113,302,055 E470G probably damaging Het
Cul5 A T 9: 53,622,871 W654R probably damaging Het
Cyp2a22 T A 7: 26,939,209 K51* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dot1l C A 10: 80,786,182 S556* probably null Het
Eif3d A T 15: 77,967,316 M98K probably benign Het
Fam205c T A 4: 42,873,032 probably null Het
Fiz1 A G 7: 5,009,168 V117A probably benign Het
Fryl A G 5: 73,100,293 V722A probably benign Het
Gm3095 G T 14: 3,964,471 R63I probably benign Het
Gm7133 A T 1: 97,269,499 noncoding transcript Het
Gm813 G A 16: 58,613,970 T128I probably benign Het
Hoxb8 A T 11: 96,284,460 D241V probably benign Het
Hrnr A G 3: 93,323,652 Q399R unknown Het
Itpk1 A T 12: 102,606,175 V93D probably damaging Het
Kars C T 8: 112,002,584 A164T probably benign Het
Kcnq4 A T 4: 120,717,011 I150N probably damaging Het
Kcnrg A T 14: 61,611,727 L212F probably damaging Het
Kif5b A T 18: 6,216,759 D521E probably benign Het
Klf11 C T 12: 24,655,072 T158M probably damaging Het
Klhl6 T C 16: 19,957,284 I175V probably benign Het
Lsm1 A G 8: 25,793,680 N40S probably damaging Het
Map1b T C 13: 99,431,068 E1715G unknown Het
Mecom C A 3: 30,238,310 A4S probably benign Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Mug2 A T 6: 122,036,296 I341L probably benign Het
Mxra7 A T 11: 116,816,252 probably null Het
Myo5a T C 9: 75,153,823 L537P probably damaging Het
Myo5b A T 18: 74,722,462 N1241Y probably damaging Het
Naa16 T C 14: 79,345,057 R531G probably damaging Het
Neb T A 2: 52,244,075 M3299L probably benign Het
Nlrp4b T A 7: 10,719,203 Y76N probably benign Het
Nmral1 T C 16: 4,716,341 T79A probably damaging Het
Noct C T 3: 51,247,879 Q23* probably null Het
Nrxn1 A T 17: 90,037,081 V438D probably damaging Het
Olfr1034 T A 2: 86,046,898 C139S probably damaging Het
Olfr1463 A C 19: 13,234,768 N173H possibly damaging Het
Oxct2a T C 4: 123,323,043 T182A probably benign Het
Pank2 T C 2: 131,274,025 I121T probably damaging Het
Pcdh1 T A 18: 38,203,475 T36S probably benign Het
Pfdn1 A T 18: 36,451,080 M67K possibly damaging Het
Plec T C 15: 76,174,256 E3849G probably damaging Het
Polr3a A T 14: 24,464,281 S817T possibly damaging Het
Ppp1r13b T A 12: 111,832,558 D891V probably damaging Het
Prr14l A G 5: 32,844,156 probably benign Het
Ptk2b A G 14: 66,173,300 probably null Het
Rab13 G C 3: 90,221,023 probably null Het
Rexo1 C T 10: 80,546,421 A751T probably benign Het
Rfx1 T C 8: 84,082,745 V233A possibly damaging Het
Rnf149 C T 1: 39,577,214 probably benign Het
Rrm1 A G 7: 102,447,879 D122G probably benign Het
Serpina1b A G 12: 103,732,380 F70S probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh3rf3 T C 10: 58,813,704 S44P possibly damaging Het
Shroom1 A G 11: 53,465,722 T471A possibly damaging Het
Slc6a1 A G 6: 114,302,831 Y152C probably damaging Het
Spata6 A T 4: 111,774,826 T145S probably damaging Het
Srcap G A 7: 127,538,014 G956D probably damaging Het
Ssh2 A T 11: 77,455,205 I1339F possibly damaging Het
Tardbp A T 4: 148,612,621 *99K probably null Het
Tbc1d22a A G 15: 86,311,836 Y336C probably damaging Het
Tmcc3 G A 10: 94,545,557 probably benign Het
Tmem178b T G 6: 40,245,613 D87E probably benign Het
Tmem184a A C 5: 139,805,622 S380A probably benign Het
Tnfaip2 A G 12: 111,445,248 K84R possibly damaging Het
Tpgs1 A G 10: 79,675,401 T126A probably benign Het
Traf3ip1 A G 1: 91,520,112 E437G possibly damaging Het
Trpc4ap C T 2: 155,635,133 C755Y probably damaging Het
Tsfm A G 10: 127,030,678 probably benign Het
Tulp1 A C 17: 28,351,837 probably benign Het
Vmn1r23 A T 6: 57,926,025 M256K probably benign Het
Zdhhc8 T C 16: 18,226,741 D305G probably damaging Het
Zfp326 G A 5: 105,907,076 R282H probably damaging Het
Other mutations in Pomgnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pomgnt1 APN 4 116152761 missense probably damaging 1.00
IGL02001:Pomgnt1 APN 4 116152908 nonsense probably null
IGL02582:Pomgnt1 APN 4 116158550 missense probably damaging 1.00
pomegranate UTSW 4 116154890 missense probably damaging 1.00
R0206:Pomgnt1 UTSW 4 116158560 critical splice donor site probably null
R0688:Pomgnt1 UTSW 4 116155889 missense probably damaging 1.00
R0890:Pomgnt1 UTSW 4 116152185 missense probably benign 0.25
R0927:Pomgnt1 UTSW 4 116151851 missense probably damaging 1.00
R1942:Pomgnt1 UTSW 4 116155275 splice site probably null
R1983:Pomgnt1 UTSW 4 116151869 missense probably damaging 1.00
R1983:Pomgnt1 UTSW 4 116151920 missense probably benign 0.12
R2034:Pomgnt1 UTSW 4 116157927 missense possibly damaging 0.87
R3721:Pomgnt1 UTSW 4 116153543 splice site probably benign
R3774:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3775:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3815:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3816:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3817:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3818:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R4447:Pomgnt1 UTSW 4 116152923 missense possibly damaging 0.75
R4583:Pomgnt1 UTSW 4 116158494 missense probably benign 0.03
R4616:Pomgnt1 UTSW 4 116154890 missense probably damaging 1.00
R4717:Pomgnt1 UTSW 4 116154215 missense possibly damaging 0.50
R4719:Pomgnt1 UTSW 4 116155775 missense probably damaging 1.00
R4747:Pomgnt1 UTSW 4 116156199 missense probably damaging 1.00
R5108:Pomgnt1 UTSW 4 116156256 intron probably benign
R5569:Pomgnt1 UTSW 4 116155967 missense probably damaging 1.00
R5821:Pomgnt1 UTSW 4 116155736 missense probably benign 0.16
R5937:Pomgnt1 UTSW 4 116153913 missense probably benign 0.01
R6052:Pomgnt1 UTSW 4 116151602 missense possibly damaging 0.91
R6745:Pomgnt1 UTSW 4 116153883 missense probably damaging 0.97
R6949:Pomgnt1 UTSW 4 116154154 missense probably damaging 0.97
R7503:Pomgnt1 UTSW 4 116152752 missense not run
T0722:Pomgnt1 UTSW 4 116137427 unclassified probably benign
T0975:Pomgnt1 UTSW 4 116137427 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCTTGTGATCTGAAGG -3'
(R):5'- GATGGACTGGCTCAGGAAAC -3'

Sequencing Primer
(F):5'- CCCTTGTGATCTGAAGGCTAGG -3'
(R):5'- CATCCCGAGATACACAATGATGTTGG -3'
Posted On2015-10-21