Incidental Mutation 'R4690:Myo5a'
ID354852
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission 041941-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R4690 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75153823 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 537 (L537P)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
Predicted Effect probably benign
Transcript: ENSMUST00000123128
AA Change: L537P

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: L537P

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably damaging
Transcript: ENSMUST00000136731
AA Change: L537P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: L537P

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155282
AA Change: L537P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: L537P

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,148,880 F436L probably damaging Het
Adam28 G T 14: 68,642,048 Q184K probably benign Het
Adh6a A G 3: 138,326,171 T275A possibly damaging Het
Agap2 A G 10: 127,091,375 D1082G possibly damaging Het
Alox5 A T 6: 116,423,189 V263E probably damaging Het
Arhgef16 C T 4: 154,287,963 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Ccdc188 T A 16: 18,218,295 H111Q probably damaging Het
Cd40 T C 2: 165,069,695 F209S possibly damaging Het
Cfap43 C A 19: 47,747,859 V1398L probably benign Het
Cln3 A T 7: 126,575,393 I286N possibly damaging Het
Col9a1 T C 1: 24,224,706 probably null Het
Cpne9 A G 6: 113,302,055 E470G probably damaging Het
Cul5 A T 9: 53,622,871 W654R probably damaging Het
Cyp2a22 T A 7: 26,939,209 K51* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dot1l C A 10: 80,786,182 S556* probably null Het
Eif3d A T 15: 77,967,316 M98K probably benign Het
Fam205c T A 4: 42,873,032 probably null Het
Fiz1 A G 7: 5,009,168 V117A probably benign Het
Fryl A G 5: 73,100,293 V722A probably benign Het
Gm3095 G T 14: 3,964,471 R63I probably benign Het
Gm7133 A T 1: 97,269,499 noncoding transcript Het
Gm813 G A 16: 58,613,970 T128I probably benign Het
Hoxb8 A T 11: 96,284,460 D241V probably benign Het
Hrnr A G 3: 93,323,652 Q399R unknown Het
Itpk1 A T 12: 102,606,175 V93D probably damaging Het
Kars C T 8: 112,002,584 A164T probably benign Het
Kcnq4 A T 4: 120,717,011 I150N probably damaging Het
Kcnrg A T 14: 61,611,727 L212F probably damaging Het
Kif5b A T 18: 6,216,759 D521E probably benign Het
Klf11 C T 12: 24,655,072 T158M probably damaging Het
Klhl6 T C 16: 19,957,284 I175V probably benign Het
Lsm1 A G 8: 25,793,680 N40S probably damaging Het
Map1b T C 13: 99,431,068 E1715G unknown Het
Mecom C A 3: 30,238,310 A4S probably benign Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Mug2 A T 6: 122,036,296 I341L probably benign Het
Mxra7 A T 11: 116,816,252 probably null Het
Myo5b A T 18: 74,722,462 N1241Y probably damaging Het
Naa16 T C 14: 79,345,057 R531G probably damaging Het
Neb T A 2: 52,244,075 M3299L probably benign Het
Nlrp4b T A 7: 10,719,203 Y76N probably benign Het
Nmral1 T C 16: 4,716,341 T79A probably damaging Het
Noct C T 3: 51,247,879 Q23* probably null Het
Nrxn1 A T 17: 90,037,081 V438D probably damaging Het
Olfr1034 T A 2: 86,046,898 C139S probably damaging Het
Olfr1463 A C 19: 13,234,768 N173H possibly damaging Het
Oxct2a T C 4: 123,323,043 T182A probably benign Het
Pank2 T C 2: 131,274,025 I121T probably damaging Het
Pcdh1 T A 18: 38,203,475 T36S probably benign Het
Pfdn1 A T 18: 36,451,080 M67K possibly damaging Het
Plec T C 15: 76,174,256 E3849G probably damaging Het
Polr3a A T 14: 24,464,281 S817T possibly damaging Het
Pomgnt1 T A 4: 116,155,510 D401E probably damaging Het
Ppp1r13b T A 12: 111,832,558 D891V probably damaging Het
Prr14l A G 5: 32,844,156 probably benign Het
Ptk2b A G 14: 66,173,300 probably null Het
Rab13 G C 3: 90,221,023 probably null Het
Rexo1 C T 10: 80,546,421 A751T probably benign Het
Rfx1 T C 8: 84,082,745 V233A possibly damaging Het
Rnf149 C T 1: 39,577,214 probably benign Het
Rrm1 A G 7: 102,447,879 D122G probably benign Het
Serpina1b A G 12: 103,732,380 F70S probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh3rf3 T C 10: 58,813,704 S44P possibly damaging Het
Shroom1 A G 11: 53,465,722 T471A possibly damaging Het
Slc6a1 A G 6: 114,302,831 Y152C probably damaging Het
Spata6 A T 4: 111,774,826 T145S probably damaging Het
Srcap G A 7: 127,538,014 G956D probably damaging Het
Ssh2 A T 11: 77,455,205 I1339F possibly damaging Het
Tardbp A T 4: 148,612,621 *99K probably null Het
Tbc1d22a A G 15: 86,311,836 Y336C probably damaging Het
Tmcc3 G A 10: 94,545,557 probably benign Het
Tmem178b T G 6: 40,245,613 D87E probably benign Het
Tmem184a A C 5: 139,805,622 S380A probably benign Het
Tnfaip2 A G 12: 111,445,248 K84R possibly damaging Het
Tpgs1 A G 10: 79,675,401 T126A probably benign Het
Traf3ip1 A G 1: 91,520,112 E437G possibly damaging Het
Trpc4ap C T 2: 155,635,133 C755Y probably damaging Het
Tsfm A G 10: 127,030,678 probably benign Het
Tulp1 A C 17: 28,351,837 probably benign Het
Vmn1r23 A T 6: 57,926,025 M256K probably benign Het
Zdhhc8 T C 16: 18,226,741 D305G probably damaging Het
Zfp326 G A 5: 105,907,076 R282H probably damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
R7497:Myo5a UTSW 9 75197701 missense
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTCACGTGTTGTACCGG -3'
(R):5'- CCCTGAAAGGACTTTAAAGGAAGC -3'

Sequencing Primer
(F):5'- TCACGTGTTGTACCGGGTCAC -3'
(R):5'- GGACTTTAAAGGAAGCAAGTGC -3'
Posted On2015-10-21