Incidental Mutation 'R4690:Tbc1d22a'
ID354875
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene NameTBC1 domain family, member 22a
SynonymsD15Ertd781e
MMRRC Submission 041941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R4690 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location86214459-86498503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86311836 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 336 (Y336C)
Ref Sequence ENSEMBL: ENSMUSP00000065721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414]
Predicted Effect probably damaging
Transcript: ENSMUST00000063414
AA Change: Y336C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: Y336C

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (89/91)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,148,880 F436L probably damaging Het
Adam28 G T 14: 68,642,048 Q184K probably benign Het
Adh6a A G 3: 138,326,171 T275A possibly damaging Het
Agap2 A G 10: 127,091,375 D1082G possibly damaging Het
Alox5 A T 6: 116,423,189 V263E probably damaging Het
Arhgef16 C T 4: 154,287,963 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Ccdc188 T A 16: 18,218,295 H111Q probably damaging Het
Cd40 T C 2: 165,069,695 F209S possibly damaging Het
Cfap43 C A 19: 47,747,859 V1398L probably benign Het
Cln3 A T 7: 126,575,393 I286N possibly damaging Het
Col9a1 T C 1: 24,224,706 probably null Het
Cpne9 A G 6: 113,302,055 E470G probably damaging Het
Cul5 A T 9: 53,622,871 W654R probably damaging Het
Cyp2a22 T A 7: 26,939,209 K51* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dot1l C A 10: 80,786,182 S556* probably null Het
Eif3d A T 15: 77,967,316 M98K probably benign Het
Fam205c T A 4: 42,873,032 probably null Het
Fiz1 A G 7: 5,009,168 V117A probably benign Het
Fryl A G 5: 73,100,293 V722A probably benign Het
Gm3095 G T 14: 3,964,471 R63I probably benign Het
Gm7133 A T 1: 97,269,499 noncoding transcript Het
Gm813 G A 16: 58,613,970 T128I probably benign Het
Hoxb8 A T 11: 96,284,460 D241V probably benign Het
Hrnr A G 3: 93,323,652 Q399R unknown Het
Itpk1 A T 12: 102,606,175 V93D probably damaging Het
Kars C T 8: 112,002,584 A164T probably benign Het
Kcnq4 A T 4: 120,717,011 I150N probably damaging Het
Kcnrg A T 14: 61,611,727 L212F probably damaging Het
Kif5b A T 18: 6,216,759 D521E probably benign Het
Klf11 C T 12: 24,655,072 T158M probably damaging Het
Klhl6 T C 16: 19,957,284 I175V probably benign Het
Lsm1 A G 8: 25,793,680 N40S probably damaging Het
Map1b T C 13: 99,431,068 E1715G unknown Het
Mecom C A 3: 30,238,310 A4S probably benign Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Mug2 A T 6: 122,036,296 I341L probably benign Het
Mxra7 A T 11: 116,816,252 probably null Het
Myo5a T C 9: 75,153,823 L537P probably damaging Het
Myo5b A T 18: 74,722,462 N1241Y probably damaging Het
Naa16 T C 14: 79,345,057 R531G probably damaging Het
Neb T A 2: 52,244,075 M3299L probably benign Het
Nlrp4b T A 7: 10,719,203 Y76N probably benign Het
Nmral1 T C 16: 4,716,341 T79A probably damaging Het
Noct C T 3: 51,247,879 Q23* probably null Het
Nrxn1 A T 17: 90,037,081 V438D probably damaging Het
Olfr1034 T A 2: 86,046,898 C139S probably damaging Het
Olfr1463 A C 19: 13,234,768 N173H possibly damaging Het
Oxct2a T C 4: 123,323,043 T182A probably benign Het
Pank2 T C 2: 131,274,025 I121T probably damaging Het
Pcdh1 T A 18: 38,203,475 T36S probably benign Het
Pfdn1 A T 18: 36,451,080 M67K possibly damaging Het
Plec T C 15: 76,174,256 E3849G probably damaging Het
Polr3a A T 14: 24,464,281 S817T possibly damaging Het
Pomgnt1 T A 4: 116,155,510 D401E probably damaging Het
Ppp1r13b T A 12: 111,832,558 D891V probably damaging Het
Prr14l A G 5: 32,844,156 probably benign Het
Ptk2b A G 14: 66,173,300 probably null Het
Rab13 G C 3: 90,221,023 probably null Het
Rexo1 C T 10: 80,546,421 A751T probably benign Het
Rfx1 T C 8: 84,082,745 V233A possibly damaging Het
Rnf149 C T 1: 39,577,214 probably benign Het
Rrm1 A G 7: 102,447,879 D122G probably benign Het
Serpina1b A G 12: 103,732,380 F70S probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh3rf3 T C 10: 58,813,704 S44P possibly damaging Het
Shroom1 A G 11: 53,465,722 T471A possibly damaging Het
Slc6a1 A G 6: 114,302,831 Y152C probably damaging Het
Spata6 A T 4: 111,774,826 T145S probably damaging Het
Srcap G A 7: 127,538,014 G956D probably damaging Het
Ssh2 A T 11: 77,455,205 I1339F possibly damaging Het
Tardbp A T 4: 148,612,621 *99K probably null Het
Tmcc3 G A 10: 94,545,557 probably benign Het
Tmem178b T G 6: 40,245,613 D87E probably benign Het
Tmem184a A C 5: 139,805,622 S380A probably benign Het
Tnfaip2 A G 12: 111,445,248 K84R possibly damaging Het
Tpgs1 A G 10: 79,675,401 T126A probably benign Het
Traf3ip1 A G 1: 91,520,112 E437G possibly damaging Het
Trpc4ap C T 2: 155,635,133 C755Y probably damaging Het
Tsfm A G 10: 127,030,678 probably benign Het
Tulp1 A C 17: 28,351,837 probably benign Het
Vmn1r23 A T 6: 57,926,025 M256K probably benign Het
Zdhhc8 T C 16: 18,226,741 D305G probably damaging Het
Zfp326 G A 5: 105,907,076 R282H probably damaging Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86301555 missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86391203 missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86299669 missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86239171 missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86299684 missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86292134 missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86496826 missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86351651 splice site probably null
R1703:Tbc1d22a UTSW 15 86239215 missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1925:Tbc1d22a UTSW 15 86239149 missense probably damaging 1.00
R2014:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86391065 splice site probably null
R4380:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86235685 missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4883:Tbc1d22a UTSW 15 86496916 missense possibly damaging 0.91
R4920:Tbc1d22a UTSW 15 86311748 missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86391086 missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86351728 missense probably damaging 0.98
R5916:Tbc1d22a UTSW 15 86214608 missense possibly damaging 0.57
R6360:Tbc1d22a UTSW 15 86214629 missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86301567 missense possibly damaging 0.48
R7138:Tbc1d22a UTSW 15 86239155 missense not run
Predicted Primers PCR Primer
(F):5'- TGCCTTAGTGTTGGAGACAG -3'
(R):5'- ATGGATGGACTCTTTAGAGAACCC -3'

Sequencing Primer
(F):5'- GTGTTGGAGACAGTGAGAAATATTG -3'
(R):5'- GGACTCTTTAGAGAACCCTGACTAG -3'
Posted On2015-10-21