Incidental Mutation 'R0206:A530064D06Rik'
ID35488
Institutional Source Beutler Lab
Gene Symbol A530064D06Rik
Ensembl Gene ENSMUSG00000043939
Gene NameRIKEN cDNA A530064D06 gene
Synonyms
MMRRC Submission 038459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0206 (G1)
Quality Score186
Status Validated
Chromosome17
Chromosomal Location48151896-48167270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48163318 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 165 (T165I)
Ref Sequence ENSEMBL: ENSMUSP00000055935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027764] [ENSMUST00000053612]
Predicted Effect probably benign
Transcript: ENSMUST00000027764
SMART Domains Protein: ENSMUSP00000027764
Gene: ENSMUSG00000043939

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 144 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053612
AA Change: T165I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055935
Gene: ENSMUSG00000043939
AA Change: T165I

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 26 122 1.56e-5 SMART
low complexity region 147 166 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
Meta Mutation Damage Score 0.1584 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,282,662 C5R probably damaging Het
4930430F08Rik T A 10: 100,586,194 K69* probably null Het
A830010M20Rik A G 5: 107,505,040 T304A probably benign Het
Acsl5 A G 19: 55,280,569 K221E probably benign Het
Adam26a A C 8: 43,570,418 F12V possibly damaging Het
Adgrb2 T C 4: 129,992,559 L164P probably damaging Het
Aldh1l1 T C 6: 90,569,866 F384L possibly damaging Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdca3 C T 6: 124,832,551 probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Cit A T 5: 115,994,030 N1782Y possibly damaging Het
Cmya5 A G 13: 93,095,557 S1008P probably damaging Het
Csgalnact2 T G 6: 118,114,386 Q197P probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Ddt A G 10: 75,772,885 M1T probably null Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Fam192a A G 8: 94,588,011 F73S probably damaging Het
Gabra6 C T 11: 42,317,079 W188* probably null Het
Gnptab A T 10: 88,439,510 H1111L probably damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Inpp5k T C 11: 75,631,143 I15T probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Kctd8 A T 5: 69,341,165 V46E probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Me3 A T 7: 89,849,660 T483S probably benign Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mvk C T 5: 114,458,974 T334M probably damaging Het
Mxra8 T A 4: 155,842,596 I329N probably damaging Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Myom1 T C 17: 71,037,297 S266P probably damaging Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr308 T C 7: 86,321,646 Y102C probably benign Het
Olfr412 A T 11: 74,365,142 I158F probably benign Het
Olfr690 A T 7: 105,329,883 M103K possibly damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Pomgnt1 T C 4: 116,158,560 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rmdn2 T A 17: 79,650,287 probably benign Het
Ryr2 A G 13: 11,676,251 probably benign Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Slc1a3 A G 15: 8,708,556 probably benign Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Snx33 G A 9: 56,926,224 S187L probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tinag A G 9: 76,999,852 I367T probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ube4b T C 4: 149,398,637 H58R probably benign Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Usp28 A G 9: 49,028,269 Y275C probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Vps13c A G 9: 67,939,162 probably benign Het
Vwf T C 6: 125,637,456 F1100S probably damaging Het
Zfp318 G T 17: 46,399,019 R556L probably benign Het
Zkscan1 T A 5: 138,101,186 C391S probably damaging Het
Other mutations in A530064D06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:A530064D06Rik APN 17 48152940 missense probably damaging 0.99
IGL01761:A530064D06Rik APN 17 48152959 missense possibly damaging 0.91
IGL02001:A530064D06Rik APN 17 48166674 missense possibly damaging 0.74
IGL02995:A530064D06Rik APN 17 48163288 missense probably benign 0.23
IGL03109:A530064D06Rik APN 17 48166460 missense probably benign 0.13
FR4340:A530064D06Rik UTSW 17 48163381 small deletion probably benign
FR4589:A530064D06Rik UTSW 17 48163381 small deletion probably benign
IGL02984:A530064D06Rik UTSW 17 48163280 missense probably benign 0.06
R0206:A530064D06Rik UTSW 17 48163318 missense probably benign 0.00
R0660:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0664:A530064D06Rik UTSW 17 48166591 missense probably benign 0.18
R0671:A530064D06Rik UTSW 17 48166656 missense probably benign 0.05
R1587:A530064D06Rik UTSW 17 48166417 missense probably benign 0.20
R4087:A530064D06Rik UTSW 17 48166510 missense probably damaging 0.96
R4089:A530064D06Rik UTSW 17 48166510 missense probably damaging 0.96
R4963:A530064D06Rik UTSW 17 48163414 missense probably benign 0.34
R5060:A530064D06Rik UTSW 17 48166939 missense probably damaging 1.00
R5083:A530064D06Rik UTSW 17 48166390 missense possibly damaging 0.86
R5219:A530064D06Rik UTSW 17 48163350 missense possibly damaging 0.70
R6175:A530064D06Rik UTSW 17 48152848 missense possibly damaging 0.91
R6189:A530064D06Rik UTSW 17 48167054 start gained probably benign
R6420:A530064D06Rik UTSW 17 48166398 missense probably damaging 1.00
R6439:A530064D06Rik UTSW 17 48166485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAACACAGGAGCCACCTACAC -3'
(R):5'- AGCTCAAGAAGTCTCTCCTCACGCC -3'

Sequencing Primer
(F):5'- CGGGAAATTCCCATATAGAGTATTG -3'
(R):5'- tccatttctcttcacctactcatc -3'
Posted On2013-05-09