Incidental Mutation 'R4690:Olfr1463'
ID354885
Institutional Source Beutler Lab
Gene Symbol Olfr1463
Ensembl Gene ENSMUSG00000096365
Gene Nameolfactory receptor 1463
SynonymsMOR202-29P, GA_x6K02T2RE5P-3560863-3561795
MMRRC Submission 041941-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4690 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13231328-13236400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13234768 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 173 (N173H)
Ref Sequence ENSEMBL: ENSMUSP00000146566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064102] [ENSMUST00000207246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064102
AA Change: N173H

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070872
Gene: ENSMUSG00000096365
AA Change: N173H

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3.2e-6 PFAM
Pfam:7tm_1 42 291 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207246
AA Change: N173H

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,148,880 F436L probably damaging Het
Adam28 G T 14: 68,642,048 Q184K probably benign Het
Adh6a A G 3: 138,326,171 T275A possibly damaging Het
Agap2 A G 10: 127,091,375 D1082G possibly damaging Het
Alox5 A T 6: 116,423,189 V263E probably damaging Het
Arhgef16 C T 4: 154,287,963 probably null Het
Bspry G A 4: 62,486,525 R186Q probably damaging Het
Ccdc188 T A 16: 18,218,295 H111Q probably damaging Het
Cd40 T C 2: 165,069,695 F209S possibly damaging Het
Cfap43 C A 19: 47,747,859 V1398L probably benign Het
Cln3 A T 7: 126,575,393 I286N possibly damaging Het
Col9a1 T C 1: 24,224,706 probably null Het
Cpne9 A G 6: 113,302,055 E470G probably damaging Het
Cul5 A T 9: 53,622,871 W654R probably damaging Het
Cyp2a22 T A 7: 26,939,209 K51* probably null Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dot1l C A 10: 80,786,182 S556* probably null Het
Eif3d A T 15: 77,967,316 M98K probably benign Het
Fam205c T A 4: 42,873,032 probably null Het
Fiz1 A G 7: 5,009,168 V117A probably benign Het
Fryl A G 5: 73,100,293 V722A probably benign Het
Gm3095 G T 14: 3,964,471 R63I probably benign Het
Gm7133 A T 1: 97,269,499 noncoding transcript Het
Gm813 G A 16: 58,613,970 T128I probably benign Het
Hoxb8 A T 11: 96,284,460 D241V probably benign Het
Hrnr A G 3: 93,323,652 Q399R unknown Het
Itpk1 A T 12: 102,606,175 V93D probably damaging Het
Kars C T 8: 112,002,584 A164T probably benign Het
Kcnq4 A T 4: 120,717,011 I150N probably damaging Het
Kcnrg A T 14: 61,611,727 L212F probably damaging Het
Kif5b A T 18: 6,216,759 D521E probably benign Het
Klf11 C T 12: 24,655,072 T158M probably damaging Het
Klhl6 T C 16: 19,957,284 I175V probably benign Het
Lsm1 A G 8: 25,793,680 N40S probably damaging Het
Map1b T C 13: 99,431,068 E1715G unknown Het
Mecom C A 3: 30,238,310 A4S probably benign Het
Muc5b G A 7: 141,842,294 V96M unknown Het
Mug2 A T 6: 122,036,296 I341L probably benign Het
Mxra7 A T 11: 116,816,252 probably null Het
Myo5a T C 9: 75,153,823 L537P probably damaging Het
Myo5b A T 18: 74,722,462 N1241Y probably damaging Het
Naa16 T C 14: 79,345,057 R531G probably damaging Het
Neb T A 2: 52,244,075 M3299L probably benign Het
Nlrp4b T A 7: 10,719,203 Y76N probably benign Het
Nmral1 T C 16: 4,716,341 T79A probably damaging Het
Noct C T 3: 51,247,879 Q23* probably null Het
Nrxn1 A T 17: 90,037,081 V438D probably damaging Het
Olfr1034 T A 2: 86,046,898 C139S probably damaging Het
Oxct2a T C 4: 123,323,043 T182A probably benign Het
Pank2 T C 2: 131,274,025 I121T probably damaging Het
Pcdh1 T A 18: 38,203,475 T36S probably benign Het
Pfdn1 A T 18: 36,451,080 M67K possibly damaging Het
Plec T C 15: 76,174,256 E3849G probably damaging Het
Polr3a A T 14: 24,464,281 S817T possibly damaging Het
Pomgnt1 T A 4: 116,155,510 D401E probably damaging Het
Ppp1r13b T A 12: 111,832,558 D891V probably damaging Het
Prr14l A G 5: 32,844,156 probably benign Het
Ptk2b A G 14: 66,173,300 probably null Het
Rab13 G C 3: 90,221,023 probably null Het
Rexo1 C T 10: 80,546,421 A751T probably benign Het
Rfx1 T C 8: 84,082,745 V233A possibly damaging Het
Rnf149 C T 1: 39,577,214 probably benign Het
Rrm1 A G 7: 102,447,879 D122G probably benign Het
Serpina1b A G 12: 103,732,380 F70S probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Sh3rf3 T C 10: 58,813,704 S44P possibly damaging Het
Shroom1 A G 11: 53,465,722 T471A possibly damaging Het
Slc6a1 A G 6: 114,302,831 Y152C probably damaging Het
Spata6 A T 4: 111,774,826 T145S probably damaging Het
Srcap G A 7: 127,538,014 G956D probably damaging Het
Ssh2 A T 11: 77,455,205 I1339F possibly damaging Het
Tardbp A T 4: 148,612,621 *99K probably null Het
Tbc1d22a A G 15: 86,311,836 Y336C probably damaging Het
Tmcc3 G A 10: 94,545,557 probably benign Het
Tmem178b T G 6: 40,245,613 D87E probably benign Het
Tmem184a A C 5: 139,805,622 S380A probably benign Het
Tnfaip2 A G 12: 111,445,248 K84R possibly damaging Het
Tpgs1 A G 10: 79,675,401 T126A probably benign Het
Traf3ip1 A G 1: 91,520,112 E437G possibly damaging Het
Trpc4ap C T 2: 155,635,133 C755Y probably damaging Het
Tsfm A G 10: 127,030,678 probably benign Het
Tulp1 A C 17: 28,351,837 probably benign Het
Vmn1r23 A T 6: 57,926,025 M256K probably benign Het
Zdhhc8 T C 16: 18,226,741 D305G probably damaging Het
Zfp326 G A 5: 105,907,076 R282H probably damaging Het
Other mutations in Olfr1463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Olfr1463 APN 19 13234739 missense probably benign 0.01
IGL02596:Olfr1463 APN 19 13234399 missense probably damaging 1.00
IGL03030:Olfr1463 APN 19 13235054 missense probably damaging 0.98
IGL03232:Olfr1463 APN 19 13234977 nonsense probably null
IGL03380:Olfr1463 APN 19 13235001 missense probably benign 0.00
PIT4382001:Olfr1463 UTSW 19 13234895 missense probably damaging 1.00
PIT4519001:Olfr1463 UTSW 19 13234852 missense probably benign 0.00
R0652:Olfr1463 UTSW 19 13234535 missense possibly damaging 0.80
R0658:Olfr1463 UTSW 19 13235060 missense possibly damaging 0.94
R1181:Olfr1463 UTSW 19 13234831 missense probably benign 0.07
R1239:Olfr1463 UTSW 19 13234676 missense possibly damaging 0.80
R1316:Olfr1463 UTSW 19 13234439 missense probably damaging 1.00
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1900:Olfr1463 UTSW 19 13234913 missense possibly damaging 0.54
R1927:Olfr1463 UTSW 19 13235029 missense probably damaging 1.00
R2239:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R2380:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R3760:Olfr1463 UTSW 19 13234886 missense probably damaging 1.00
R3765:Olfr1463 UTSW 19 13234431 missense probably damaging 1.00
R3835:Olfr1463 UTSW 19 13234739 missense probably benign 0.18
R4907:Olfr1463 UTSW 19 13234793 missense probably damaging 1.00
R5444:Olfr1463 UTSW 19 13234958 missense probably benign 0.28
R5465:Olfr1463 UTSW 19 13234688 missense probably benign 0.00
R6083:Olfr1463 UTSW 19 13234525 missense probably benign 0.01
R6259:Olfr1463 UTSW 19 13234421 missense probably damaging 0.98
R6324:Olfr1463 UTSW 19 13235104 missense possibly damaging 0.95
R6561:Olfr1463 UTSW 19 13235030 missense probably damaging 1.00
R6845:Olfr1463 UTSW 19 13234633 missense probably damaging 1.00
X0063:Olfr1463 UTSW 19 13234635 missense probably damaging 1.00
X0067:Olfr1463 UTSW 19 13234697 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTGGAAAATTACCTGTTGGCC -3'
(R):5'- AGCACAGGTAGAAATAGCCTTC -3'

Sequencing Primer
(F):5'- GGAAAATTACCTGTTGGCCTCAATGG -3'
(R):5'- GAAATAGCCTTCTGAAGTCCTGC -3'
Posted On2015-10-21