Incidental Mutation 'R4691:Clca3b'
ID354896
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission 041942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4691 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144839092 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 378 (T378I)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: T378I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: T378I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca13 A T 11: 9,434,195 R3882S probably damaging Het
Adamts2 G T 11: 50,756,696 V299F probably damaging Het
Ankrd50 A G 3: 38,483,010 S65P probably benign Het
Ap4e1 T C 2: 127,061,871 C898R probably benign Het
Arel1 A T 12: 84,930,249 probably null Het
Bag6 T A 17: 35,139,248 V164D probably damaging Het
C2cd5 A G 6: 143,030,148 S769P possibly damaging Het
Cables1 C T 18: 11,840,523 Q240* probably null Het
Ccnb1-ps T A 7: 42,106,092 noncoding transcript Het
Ccz1 A T 5: 143,991,562 I390N possibly damaging Het
Ces1a T C 8: 93,032,659 H283R probably benign Het
Cpne2 A T 8: 94,558,221 I342F probably damaging Het
Cyp2d9 A G 15: 82,455,832 D141G probably damaging Het
Ddias T A 7: 92,858,816 K630N probably damaging Het
Dennd4b A G 3: 90,272,312 T626A probably damaging Het
Disc1 T C 8: 125,148,447 V554A possibly damaging Het
Dnah10 A G 5: 124,775,517 T1880A probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epop C T 11: 97,628,893 G130D possibly damaging Het
Erap1 T C 13: 74,673,692 L722P probably damaging Het
Eya4 T A 10: 23,140,068 T334S probably benign Het
Ezr T C 17: 6,759,562 I5V probably benign Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Galnt12 T C 4: 47,104,143 S134P probably damaging Het
Gcfc2 T A 6: 81,941,427 L366* probably null Het
Gins4 T A 8: 23,237,059 D6V probably benign Het
Gm1113 T C 9: 35,516,862 S106G possibly damaging Het
Gm5155 T A 7: 17,908,966 S434T possibly damaging Het
Grid1 A G 14: 35,569,557 H807R probably benign Het
H2-T22 GTTTT GTTT 17: 36,041,570 probably null Het
Ighv1-66 T C 12: 115,593,309 Y51C probably benign Het
Inpp4b A T 8: 82,122,653 Y901F probably damaging Het
Irf2 T A 8: 46,846,187 S339T probably damaging Het
Itgae G T 11: 73,119,519 G612* probably null Het
Kdr T C 5: 75,944,599 K1037R possibly damaging Het
Mro A T 18: 73,873,326 M115L probably benign Het
Myo5a A G 9: 75,180,156 E1098G probably damaging Het
Nkx2-1 T A 12: 56,533,565 M197L probably benign Het
Olfr58 T C 9: 19,783,382 I83T probably benign Het
Pank2 T A 2: 131,296,281 F430L possibly damaging Het
Pcx T A 19: 4,619,477 V794E probably damaging Het
Pdgfd C T 9: 6,288,556 P70L probably damaging Het
Pla2g4e T C 2: 120,174,300 Y521C probably damaging Het
Pou5f1 T A 17: 35,506,131 F11Y probably damaging Het
Prdm9 A G 17: 15,553,378 M252T probably benign Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rad51ap1 A G 6: 126,927,553 S123P probably benign Het
Robo3 T C 9: 37,425,218 E418G probably damaging Het
Sos2 C T 12: 69,616,328 R631H probably damaging Het
St3gal2 C T 8: 110,957,785 T25I probably benign Het
Stra6l G A 4: 45,882,851 A521T probably benign Het
Syt7 T A 19: 10,426,481 L177Q probably damaging Het
Tet2 T A 3: 133,486,083 Q863H possibly damaging Het
Tmem232 T C 17: 65,265,242 K585E possibly damaging Het
Trpc6 A C 9: 8,652,978 E595A probably damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Vmn2r72 A T 7: 85,737,911 L815* probably null Het
Vmn2r81 C T 10: 79,293,377 Q701* probably null Het
Vps13c T C 9: 67,952,935 V2811A possibly damaging Het
Zfp354a A G 11: 51,070,237 E425G probably damaging Het
Zfp617 A T 8: 71,932,815 T330S probably benign Het
Zfp663 G T 2: 165,359,130 probably benign Het
Zfp84 T C 7: 29,777,080 L399P probably damaging Het
Zfp869 A T 8: 69,706,863 C353* probably null Het
Zscan22 C T 7: 12,906,561 A85V probably benign Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGGAAGGCTACTTTCTCTACAC -3'
(R):5'- TTTTGTTTAAACAGGGAAGCCC -3'

Sequencing Primer
(F):5'- GGAAGGCTACTTTCTCTACACAGATG -3'
(R):5'- GAAGCCCCATCACTCGTCTG -3'
Posted On2015-10-21