Incidental Mutation 'R4691:Inpp4b'
ID354916
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Nameinositol polyphosphate-4-phosphatase, type II
SynonymsE130107I17Rik
MMRRC Submission 041942-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4691 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location81342556-82127914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82122653 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 901 (Y901F)
Ref Sequence ENSEMBL: ENSMUSP00000148972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169387] [ENSMUST00000172031] [ENSMUST00000215332] [ENSMUST00000217122]
Predicted Effect probably benign
Transcript: ENSMUST00000042529
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109851
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109852
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: Y901F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: Y901F

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: Y901F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000217122
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca13 A T 11: 9,434,195 R3882S probably damaging Het
Adamts2 G T 11: 50,756,696 V299F probably damaging Het
Ankrd50 A G 3: 38,483,010 S65P probably benign Het
Ap4e1 T C 2: 127,061,871 C898R probably benign Het
Arel1 A T 12: 84,930,249 probably null Het
Bag6 T A 17: 35,139,248 V164D probably damaging Het
C2cd5 A G 6: 143,030,148 S769P possibly damaging Het
Cables1 C T 18: 11,840,523 Q240* probably null Het
Ccnb1-ps T A 7: 42,106,092 noncoding transcript Het
Ccz1 A T 5: 143,991,562 I390N possibly damaging Het
Ces1a T C 8: 93,032,659 H283R probably benign Het
Clca3b G A 3: 144,839,092 T378I probably benign Het
Cpne2 A T 8: 94,558,221 I342F probably damaging Het
Cyp2d9 A G 15: 82,455,832 D141G probably damaging Het
Ddias T A 7: 92,858,816 K630N probably damaging Het
Dennd4b A G 3: 90,272,312 T626A probably damaging Het
Disc1 T C 8: 125,148,447 V554A possibly damaging Het
Dnah10 A G 5: 124,775,517 T1880A probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epop C T 11: 97,628,893 G130D possibly damaging Het
Erap1 T C 13: 74,673,692 L722P probably damaging Het
Eya4 T A 10: 23,140,068 T334S probably benign Het
Ezr T C 17: 6,759,562 I5V probably benign Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Galnt12 T C 4: 47,104,143 S134P probably damaging Het
Gcfc2 T A 6: 81,941,427 L366* probably null Het
Gins4 T A 8: 23,237,059 D6V probably benign Het
Gm1113 T C 9: 35,516,862 S106G possibly damaging Het
Gm5155 T A 7: 17,908,966 S434T possibly damaging Het
Grid1 A G 14: 35,569,557 H807R probably benign Het
H2-T22 GTTTT GTTT 17: 36,041,570 probably null Het
Ighv1-66 T C 12: 115,593,309 Y51C probably benign Het
Irf2 T A 8: 46,846,187 S339T probably damaging Het
Itgae G T 11: 73,119,519 G612* probably null Het
Kdr T C 5: 75,944,599 K1037R possibly damaging Het
Mro A T 18: 73,873,326 M115L probably benign Het
Myo5a A G 9: 75,180,156 E1098G probably damaging Het
Nkx2-1 T A 12: 56,533,565 M197L probably benign Het
Olfr58 T C 9: 19,783,382 I83T probably benign Het
Pank2 T A 2: 131,296,281 F430L possibly damaging Het
Pcx T A 19: 4,619,477 V794E probably damaging Het
Pdgfd C T 9: 6,288,556 P70L probably damaging Het
Pla2g4e T C 2: 120,174,300 Y521C probably damaging Het
Pou5f1 T A 17: 35,506,131 F11Y probably damaging Het
Prdm9 A G 17: 15,553,378 M252T probably benign Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rad51ap1 A G 6: 126,927,553 S123P probably benign Het
Robo3 T C 9: 37,425,218 E418G probably damaging Het
Sos2 C T 12: 69,616,328 R631H probably damaging Het
St3gal2 C T 8: 110,957,785 T25I probably benign Het
Stra6l G A 4: 45,882,851 A521T probably benign Het
Syt7 T A 19: 10,426,481 L177Q probably damaging Het
Tet2 T A 3: 133,486,083 Q863H possibly damaging Het
Tmem232 T C 17: 65,265,242 K585E possibly damaging Het
Trpc6 A C 9: 8,652,978 E595A probably damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Vmn2r72 A T 7: 85,737,911 L815* probably null Het
Vmn2r81 C T 10: 79,293,377 Q701* probably null Het
Vps13c T C 9: 67,952,935 V2811A possibly damaging Het
Zfp354a A G 11: 51,070,237 E425G probably damaging Het
Zfp617 A T 8: 71,932,815 T330S probably benign Het
Zfp663 G T 2: 165,359,130 probably benign Het
Zfp84 T C 7: 29,777,080 L399P probably damaging Het
Zfp869 A T 8: 69,706,863 C353* probably null Het
Zscan22 C T 7: 12,906,561 A85V probably benign Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 81856750 missense probably damaging 1.00
IGL01481:Inpp4b APN 8 81997380 missense probably damaging 1.00
IGL01509:Inpp4b APN 8 81890703 splice site probably benign
IGL01515:Inpp4b APN 8 81952711 missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82010663 missense probably benign 0.03
IGL01643:Inpp4b APN 8 82071771 missense probably damaging 0.97
IGL01736:Inpp4b APN 8 81997339 missense probably benign 0.00
IGL02154:Inpp4b APN 8 81969501 splice site probably benign
IGL02327:Inpp4b APN 8 82041962 missense probably benign 0.01
IGL02413:Inpp4b APN 8 82033171 missense probably benign
IGL02652:Inpp4b APN 8 81770800 splice site probably benign
IGL02678:Inpp4b APN 8 81856744 missense probably damaging 1.00
IGL03146:Inpp4b APN 8 81743781 missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 81693010 intron probably benign
PIT4280001:Inpp4b UTSW 8 82034417 missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82046267 missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82041935 missense probably damaging 1.00
R0083:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 81770917 missense probably benign 0.00
R0285:Inpp4b UTSW 8 82034516 splice site probably benign
R0363:Inpp4b UTSW 8 81884257 splice site probably benign
R0364:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R0471:Inpp4b UTSW 8 82041899 missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 81997337 missense probably benign 0.00
R0562:Inpp4b UTSW 8 81768151 missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R1081:Inpp4b UTSW 8 82069024 missense probably damaging 0.97
R1251:Inpp4b UTSW 8 81890753 missense probably benign 0.01
R1374:Inpp4b UTSW 8 81743816 critical splice donor site probably null
R1445:Inpp4b UTSW 8 81952834 intron probably null
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1647:Inpp4b UTSW 8 81856774 splice site probably benign
R1754:Inpp4b UTSW 8 81770811 missense probably damaging 1.00
R1759:Inpp4b UTSW 8 81768103 missense probably benign 0.06
R2085:Inpp4b UTSW 8 81952274 missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82048489 missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82121375 nonsense probably null
R2175:Inpp4b UTSW 8 81856699 missense probably damaging 1.00
R2191:Inpp4b UTSW 8 81997302 missense probably damaging 1.00
R2401:Inpp4b UTSW 8 81997339 missense probably benign 0.00
R2475:Inpp4b UTSW 8 82041978 missense probably benign 0.09
R2512:Inpp4b UTSW 8 82010550 missense probably damaging 1.00
R2919:Inpp4b UTSW 8 81985329 missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 81902838 missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 81952261 missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R4590:Inpp4b UTSW 8 81741411 start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 81969535 missense probably damaging 0.99
R4924:Inpp4b UTSW 8 82122624 missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82033208 missense probably damaging 1.00
R5219:Inpp4b UTSW 8 81884156 missense probably benign 0.01
R5228:Inpp4b UTSW 8 81768115 missense probably damaging 0.99
R5557:Inpp4b UTSW 8 81952259 missense probably damaging 0.99
R5627:Inpp4b UTSW 8 81743816 critical splice donor site probably benign
R5691:Inpp4b UTSW 8 81890694 intron probably benign
R6186:Inpp4b UTSW 8 82046234 missense probably damaging 0.99
R6213:Inpp4b UTSW 8 81997390 missense probably damaging 1.00
R6232:Inpp4b UTSW 8 81952184 missense probably damaging 1.00
R6283:Inpp4b UTSW 8 81770833 missense probably damaging 1.00
R6302:Inpp4b UTSW 8 81768177 missense probably benign 0.00
R6309:Inpp4b UTSW 8 82041917 missense probably damaging 1.00
R6360:Inpp4b UTSW 8 81902852 missense probably benign 0.20
R6477:Inpp4b UTSW 8 81844714 unclassified probably null
R6773:Inpp4b UTSW 8 81856620 intron probably benign
R6968:Inpp4b UTSW 8 81844457 missense probably benign 0.18
R7147:Inpp4b UTSW 8 81902771 missense probably damaging 1.00
R7318:Inpp4b UTSW 8 82071745 missense probably damaging 1.00
Z1088:Inpp4b UTSW 8 82068931 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAATAATGGTATTGGGCCTG -3'
(R):5'- TCTTCATGGGAGCAACACTC -3'

Sequencing Primer
(F):5'- TTGTAAGATGTATCATCACTTGTGG -3'
(R):5'- GAGCAACACTCATGAGCGC -3'
Posted On2015-10-21