Incidental Mutation 'R4691:Ptk2b'
ID354940
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene NamePTK2 protein tyrosine kinase 2 beta
SynonymsCAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase
MMRRC Submission 041942-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R4691 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66153257-66281052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66157069 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 859 (G859S)
Ref Sequence ENSEMBL: ENSMUSP00000106750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]
Predicted Effect probably benign
Transcript: ENSMUST00000022620
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022622
AA Change: G863S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: G863S

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
AA Change: G821S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456
AA Change: G821S

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111121
AA Change: G859S

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: G859S

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148104
Predicted Effect unknown
Transcript: ENSMUST00000154865
AA Change: G235S
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456
AA Change: G235S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178730
AA Change: G863S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: G863S

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abca13 A T 11: 9,434,195 R3882S probably damaging Het
Adamts2 G T 11: 50,756,696 V299F probably damaging Het
Ankrd50 A G 3: 38,483,010 S65P probably benign Het
Ap4e1 T C 2: 127,061,871 C898R probably benign Het
Arel1 A T 12: 84,930,249 probably null Het
Bag6 T A 17: 35,139,248 V164D probably damaging Het
C2cd5 A G 6: 143,030,148 S769P possibly damaging Het
Cables1 C T 18: 11,840,523 Q240* probably null Het
Ccnb1-ps T A 7: 42,106,092 noncoding transcript Het
Ccz1 A T 5: 143,991,562 I390N possibly damaging Het
Ces1a T C 8: 93,032,659 H283R probably benign Het
Clca3b G A 3: 144,839,092 T378I probably benign Het
Cpne2 A T 8: 94,558,221 I342F probably damaging Het
Cyp2d9 A G 15: 82,455,832 D141G probably damaging Het
Ddias T A 7: 92,858,816 K630N probably damaging Het
Dennd4b A G 3: 90,272,312 T626A probably damaging Het
Disc1 T C 8: 125,148,447 V554A possibly damaging Het
Dnah10 A G 5: 124,775,517 T1880A probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Epop C T 11: 97,628,893 G130D possibly damaging Het
Erap1 T C 13: 74,673,692 L722P probably damaging Het
Eya4 T A 10: 23,140,068 T334S probably benign Het
Ezr T C 17: 6,759,562 I5V probably benign Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Galnt12 T C 4: 47,104,143 S134P probably damaging Het
Gcfc2 T A 6: 81,941,427 L366* probably null Het
Gins4 T A 8: 23,237,059 D6V probably benign Het
Gm1113 T C 9: 35,516,862 S106G possibly damaging Het
Gm5155 T A 7: 17,908,966 S434T possibly damaging Het
Grid1 A G 14: 35,569,557 H807R probably benign Het
H2-T22 GTTTT GTTT 17: 36,041,570 probably null Het
Ighv1-66 T C 12: 115,593,309 Y51C probably benign Het
Inpp4b A T 8: 82,122,653 Y901F probably damaging Het
Irf2 T A 8: 46,846,187 S339T probably damaging Het
Itgae G T 11: 73,119,519 G612* probably null Het
Kdr T C 5: 75,944,599 K1037R possibly damaging Het
Mro A T 18: 73,873,326 M115L probably benign Het
Myo5a A G 9: 75,180,156 E1098G probably damaging Het
Nkx2-1 T A 12: 56,533,565 M197L probably benign Het
Olfr58 T C 9: 19,783,382 I83T probably benign Het
Pank2 T A 2: 131,296,281 F430L possibly damaging Het
Pcx T A 19: 4,619,477 V794E probably damaging Het
Pdgfd C T 9: 6,288,556 P70L probably damaging Het
Pla2g4e T C 2: 120,174,300 Y521C probably damaging Het
Pou5f1 T A 17: 35,506,131 F11Y probably damaging Het
Prdm9 A G 17: 15,553,378 M252T probably benign Het
Rad51ap1 A G 6: 126,927,553 S123P probably benign Het
Robo3 T C 9: 37,425,218 E418G probably damaging Het
Sos2 C T 12: 69,616,328 R631H probably damaging Het
St3gal2 C T 8: 110,957,785 T25I probably benign Het
Stra6l G A 4: 45,882,851 A521T probably benign Het
Syt7 T A 19: 10,426,481 L177Q probably damaging Het
Tet2 T A 3: 133,486,083 Q863H possibly damaging Het
Tmem232 T C 17: 65,265,242 K585E possibly damaging Het
Trpc6 A C 9: 8,652,978 E595A probably damaging Het
Txnl1 A G 18: 63,671,679 V248A possibly damaging Het
Vmn2r72 A T 7: 85,737,911 L815* probably null Het
Vmn2r81 C T 10: 79,293,377 Q701* probably null Het
Vps13c T C 9: 67,952,935 V2811A possibly damaging Het
Zfp354a A G 11: 51,070,237 E425G probably damaging Het
Zfp617 A T 8: 71,932,815 T330S probably benign Het
Zfp663 G T 2: 165,359,130 probably benign Het
Zfp84 T C 7: 29,777,080 L399P probably damaging Het
Zfp869 A T 8: 69,706,863 C353* probably null Het
Zscan22 C T 7: 12,906,561 A85V probably benign Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66177118 missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66158613 missense probably benign 0.00
IGL02121:Ptk2b APN 14 66213482 missense probably benign 0.12
IGL02505:Ptk2b APN 14 66154243 missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66173895 splice site probably benign
IGL03343:Ptk2b APN 14 66169421 missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66156381 missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66213372 missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66172144 missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66177751 missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66158598 missense probably benign 0.02
R1502:Ptk2b UTSW 14 66163080 missense possibly damaging 0.95
R1583:Ptk2b UTSW 14 66163114 missense possibly damaging 0.75
R1876:Ptk2b UTSW 14 66158392 missense probably benign 0.01
R1905:Ptk2b UTSW 14 66158670 missense probably damaging 1.00
R1942:Ptk2b UTSW 14 66169381 missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66172505 missense probably benign 0.28
R2377:Ptk2b UTSW 14 66172548 missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66178183 splice site probably null
R3793:Ptk2b UTSW 14 66170251 missense probably damaging 1.00
R3836:Ptk2b UTSW 14 66156342 missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66157068 missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66163047 missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66173300 splice site probably null
R4692:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4693:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4847:Ptk2b UTSW 14 66173882 missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66156415 missense probably damaging 1.00
R5297:Ptk2b UTSW 14 66172517 missense probably benign 0.04
R5603:Ptk2b UTSW 14 66172065 nonsense probably null
R5935:Ptk2b UTSW 14 66173879 missense probably damaging 1.00
R6245:Ptk2b UTSW 14 66163066 missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66178831 missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66187474 missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66213398 missense probably damaging 1.00
R7235:Ptk2b UTSW 14 66157087 nonsense probably null
X0054:Ptk2b UTSW 14 66213328 missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66154094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCTAGTCAGGGAAGAGACC -3'
(R):5'- TCTGGCTACTGGGAAAGCAG -3'

Sequencing Primer
(F):5'- AAAAACTGGCCCGTCTCCTATTTTG -3'
(R):5'- GGAAGACCAAGATCCTATTTCCTTGG -3'
Posted On2015-10-21