Incidental Mutation 'R4692:Cwf19l2'
ID354977
Institutional Source Beutler Lab
Gene Symbol Cwf19l2
Ensembl Gene ENSMUSG00000025898
Gene NameCWF19-like 2, cell cycle control (S. pombe)
Synonyms3230401L03Rik
MMRRC Submission 041943-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.764) question?
Stock #R4692 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location3403592-3479236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3428709 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 232 (S232P)
Ref Sequence ENSEMBL: ENSMUSP00000027027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027027]
Predicted Effect probably damaging
Transcript: ENSMUST00000027027
AA Change: S232P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027027
Gene: ENSMUSG00000025898
AA Change: S232P

DomainStartEndE-ValueType
low complexity region 64 114 N/A INTRINSIC
coiled coil region 165 196 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
coiled coil region 496 524 N/A INTRINSIC
Pfam:CwfJ_C_1 655 779 1.8e-40 PFAM
Pfam:CwfJ_C_2 788 882 4.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212128
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,973,886 Y230* probably null Het
9230104M06Rik A T 12: 113,000,072 probably benign Het
Arhgap20 A G 9: 51,785,788 D53G probably damaging Het
Arl2 T C 19: 6,137,746 T54A probably damaging Het
Baz2a G A 10: 128,124,893 G1521S probably damaging Het
Begain A G 12: 109,033,892 S523P probably damaging Het
Car10 T C 11: 93,185,158 probably null Het
Cenpe A G 3: 135,216,379 I66V probably benign Het
Col14a1 T A 15: 55,423,468 V895E unknown Het
Coro1b T C 19: 4,149,419 Y26H probably damaging Het
Crebbp T C 16: 4,114,863 E1017G possibly damaging Het
Cyp7b1 T A 3: 18,072,564 I473F probably damaging Het
D430042O09Rik T C 7: 125,867,669 probably null Het
Efcab5 A T 11: 77,113,681 I937N probably damaging Het
Fam53c A C 18: 34,768,690 E220A probably damaging Het
Gsn A G 2: 35,298,871 Y434C probably damaging Het
Igkv2-137 T C 6: 67,555,987 S45P possibly damaging Het
Kif13b C A 14: 64,803,575 T1704K probably benign Het
Mapk7 A G 11: 61,489,242 S697P possibly damaging Het
Mrgpra1 T A 7: 47,335,698 I78F probably damaging Het
N6amt1 T C 16: 87,356,966 V97A possibly damaging Het
Oas3 T C 5: 120,769,355 T406A probably benign Het
Olfr1314 A G 2: 112,092,681 S7P probably damaging Het
Olfr895 C T 9: 38,268,530 Q6* probably null Het
Paxip1 T C 5: 27,772,097 probably benign Het
Pfn4 A T 12: 4,774,486 Y71F probably damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Rbl2 T A 8: 91,122,419 D1084E probably damaging Het
Robo1 T G 16: 72,960,202 S350R probably damaging Het
Sbno2 A G 10: 80,086,327 V4A possibly damaging Het
Sh3rf1 T C 8: 61,353,854 probably null Het
Smgc T C 15: 91,854,561 V474A possibly damaging Het
Snx13 A G 12: 35,086,918 D126G possibly damaging Het
Sox9 C A 11: 112,782,977 H131Q probably benign Het
Spag6 T C 2: 18,699,243 I34T probably benign Het
Speer2 T A 16: 69,857,972 T202S possibly damaging Het
Sspo T A 6: 48,482,687 C3327S probably damaging Het
Vcpip1 G T 1: 9,748,074 A28E unknown Het
Vstm5 A T 9: 15,257,422 D94V probably damaging Het
Zfp329 T C 7: 12,810,632 K322E probably damaging Het
Zfp932 G A 5: 110,009,186 G250D probably damaging Het
Zscan26 A G 13: 21,445,257 C359R probably damaging Het
Other mutations in Cwf19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Cwf19l2 APN 9 3409990 missense probably benign 0.01
IGL00573:Cwf19l2 APN 9 3450161 splice site probably benign
IGL00757:Cwf19l2 APN 9 3460054 missense probably damaging 1.00
IGL00803:Cwf19l2 APN 9 3430810 missense probably benign 0.41
IGL01916:Cwf19l2 APN 9 3477869 missense possibly damaging 0.82
IGL02315:Cwf19l2 APN 9 3410030 missense probably damaging 1.00
IGL02419:Cwf19l2 APN 9 3418777 critical splice donor site probably null
IGL02427:Cwf19l2 APN 9 3456817 missense probably benign 0.00
IGL03026:Cwf19l2 APN 9 3428777 missense probably benign 0.28
IGL03028:Cwf19l2 APN 9 3430622 missense probably benign 0.26
IGL03199:Cwf19l2 APN 9 3477830 missense probably damaging 1.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0015:Cwf19l2 UTSW 9 3454666 missense probably benign 0.00
R0532:Cwf19l2 UTSW 9 3431057 missense probably benign 0.38
R0724:Cwf19l2 UTSW 9 3421377 critical splice donor site probably null
R0924:Cwf19l2 UTSW 9 3441047 splice site probably benign
R0947:Cwf19l2 UTSW 9 3421286 missense probably benign 0.16
R1210:Cwf19l2 UTSW 9 3430810 missense probably benign 0.00
R1393:Cwf19l2 UTSW 9 3456818 missense probably benign 0.01
R1541:Cwf19l2 UTSW 9 3456760 missense probably damaging 1.00
R1594:Cwf19l2 UTSW 9 3430973 missense probably benign
R1870:Cwf19l2 UTSW 9 3458802 missense possibly damaging 0.56
R1950:Cwf19l2 UTSW 9 3418674 missense probably benign
R1996:Cwf19l2 UTSW 9 3417947 missense probably benign 0.01
R2005:Cwf19l2 UTSW 9 3430720 missense possibly damaging 0.92
R2246:Cwf19l2 UTSW 9 3430661 missense probably benign 0.16
R2420:Cwf19l2 UTSW 9 3411341 missense possibly damaging 0.80
R3051:Cwf19l2 UTSW 9 3410006 missense probably benign 0.05
R3738:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R3915:Cwf19l2 UTSW 9 3456776 missense probably damaging 1.00
R4034:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4035:Cwf19l2 UTSW 9 3456803 missense probably benign 0.01
R4323:Cwf19l2 UTSW 9 3430452 missense probably damaging 0.99
R4328:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4329:Cwf19l2 UTSW 9 3458878 missense probably damaging 1.00
R4775:Cwf19l2 UTSW 9 3430973 missense probably benign
R4779:Cwf19l2 UTSW 9 3410035 missense possibly damaging 0.95
R4822:Cwf19l2 UTSW 9 3458839 missense probably damaging 1.00
R4833:Cwf19l2 UTSW 9 3430783 missense probably benign 0.28
R5110:Cwf19l2 UTSW 9 3450012 critical splice acceptor site probably null
R5120:Cwf19l2 UTSW 9 3418761 nonsense probably null
R5164:Cwf19l2 UTSW 9 3475511 missense probably damaging 1.00
R5440:Cwf19l2 UTSW 9 3475549 missense probably damaging 1.00
R5567:Cwf19l2 UTSW 9 3456831 missense probably damaging 1.00
R5594:Cwf19l2 UTSW 9 3418773 missense probably benign 0.42
R5960:Cwf19l2 UTSW 9 3411404 missense probably benign 0.43
R6222:Cwf19l2 UTSW 9 3454569 nonsense probably null
R6259:Cwf19l2 UTSW 9 3458879 missense probably damaging 1.00
R6688:Cwf19l2 UTSW 9 3450015 missense probably benign 0.00
R6983:Cwf19l2 UTSW 9 3477817 missense probably damaging 1.00
T0722:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0003:Cwf19l2 UTSW 9 3456755 missense probably benign 0.00
X0020:Cwf19l2 UTSW 9 3418662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATGACAAGCCTTTATACCTTG -3'
(R):5'- TCCTTACATAATCACAAGCAGGAAG -3'

Sequencing Primer
(F):5'- GCCTTTATACCTTGTAAAAGTAGGC -3'
(R):5'- GTTTCAAGACTCCAAACAAA -3'
Posted On2015-10-21