Incidental Mutation 'R4693:Adar'
ID355015
Institutional Source Beutler Lab
Gene Symbol Adar
Ensembl Gene ENSMUSG00000027951
Gene Nameadenosine deaminase, RNA-specific
SynonymsAdar1p150, ADAR1, mZaADAR, Adar1p110
MMRRC Submission 041944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4693 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89715022-89753446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89735940 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 128 (H128L)
Ref Sequence ENSEMBL: ENSMUSP00000096525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029563] [ENSMUST00000098924] [ENSMUST00000107405] [ENSMUST00000118341] [ENSMUST00000121094]
Predicted Effect probably benign
Transcript: ENSMUST00000029563
AA Change: H376L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029563
Gene: ENSMUSG00000027951
AA Change: H376L

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
ADEAMc 762 1145 3.74e-205 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098924
AA Change: H128L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096525
Gene: ENSMUSG00000027951
AA Change: H128L

DomainStartEndE-ValueType
Zalpha 1 64 3.1e-24 SMART
low complexity region 74 89 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
DSRM 209 275 3.6e-21 SMART
DSRM 320 386 4.36e-20 SMART
DSRM 428 494 1.58e-17 SMART
low complexity region 515 526 N/A INTRINSIC
ADEAMc 540 923 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107405
AA Change: H376L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103028
Gene: ENSMUSG00000027951
AA Change: H376L

DomainStartEndE-ValueType
Zalpha 134 203 8.97e-30 SMART
Zalpha 244 312 7.69e-29 SMART
low complexity region 322 337 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
DSRM 457 523 3.6e-21 SMART
DSRM 568 634 4.36e-20 SMART
DSRM 676 742 1.58e-17 SMART
low complexity region 763 774 N/A INTRINSIC
ADEAMc 788 1171 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118341
SMART Domains Protein: ENSMUSP00000113453
Gene: ENSMUSG00000027951

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
low complexity region 245 256 N/A INTRINSIC
ADEAMc 270 653 3.74e-205 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121094
SMART Domains Protein: ENSMUSP00000112969
Gene: ENSMUSG00000027951

DomainStartEndE-ValueType
DSRM 50 116 4.36e-20 SMART
DSRM 158 224 1.58e-17 SMART
ADEAMc 244 627 3.74e-205 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150637
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mice die during gestation. Inactivation of this locus has been associated with increased apoptosis and, in some lines, defects in both primitive and definitive hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,696,697 Y478H probably damaging Het
Angptl6 G T 9: 20,875,302 D349E probably damaging Het
Anxa9 T C 3: 95,297,356 T286A probably benign Het
Apobr A G 7: 126,586,847 N510S probably damaging Het
Atoh7 G T 10: 63,100,496 R114L probably benign Het
Bank1 C G 3: 136,247,676 R106P probably damaging Het
Best1 C T 19: 9,997,135 G15D probably damaging Het
Best2 A T 8: 85,011,203 F188I probably damaging Het
Ccdc88a T C 11: 29,482,241 Y344H probably damaging Het
Col6a5 A G 9: 105,937,172 L547P unknown Het
Cyp19a1 A T 9: 54,173,333 S247T possibly damaging Het
Cyp26a1 T C 19: 37,698,477 S126P probably benign Het
Dab1 G T 4: 104,679,553 C180F probably damaging Het
Dclk2 T C 3: 86,815,093 D412G possibly damaging Het
Dspp A T 5: 104,178,062 S764C unknown Het
Dync1li1 C A 9: 114,706,098 D143E probably damaging Het
Esm1 A T 13: 113,210,060 D73V probably damaging Het
Etfdh A T 3: 79,605,803 V431E probably damaging Het
Fam83c C T 2: 155,830,234 R427H probably damaging Het
Galnt9 A G 5: 110,615,509 Y93C probably damaging Het
Gm6818 G A 7: 38,400,702 noncoding transcript Het
Gm884 T A 11: 103,619,860 E427D unknown Het
Gm8979 T G 7: 106,082,378 noncoding transcript Het
Gosr2 A G 11: 103,683,929 S114P probably benign Het
Grip1 G A 10: 120,000,554 V444I probably benign Het
Haus4 G T 14: 54,549,799 A67E probably benign Het
Hectd2 T A 19: 36,614,338 probably benign Het
Kndc1 T C 7: 139,921,779 Y911H probably benign Het
Lim2 T C 7: 43,430,681 Y31H probably damaging Het
Lims2 G A 18: 31,944,499 R101H probably benign Het
Lrrc2 T A 9: 110,970,093 M236K probably damaging Het
Lrrk1 T C 7: 66,262,487 Y1775C probably damaging Het
Mdga2 A G 12: 66,797,633 V197A possibly damaging Het
Mfhas1 T A 8: 35,589,175 L268Q probably damaging Het
Mlh1 A G 9: 111,255,658 I216T probably damaging Het
Mrc2 G A 11: 105,343,702 C1016Y probably benign Het
Mvp C A 7: 126,998,328 V168F probably damaging Het
Mybphl A G 3: 108,375,178 T176A probably benign Het
Myt1 T A 2: 181,795,739 L81Q probably damaging Het
Ncbp3 T C 11: 73,075,677 L453S probably benign Het
Olfr1157 A T 2: 87,962,709 F61Y probably benign Het
Olfr1219 T C 2: 89,075,068 T8A possibly damaging Het
Olfr1231 T A 2: 89,303,277 E105V probably benign Het
Olfr1456-ps1 C A 19: 13,078,862 noncoding transcript Het
Olfr545 T A 7: 102,494,452 I108F probably damaging Het
Pak4 A T 7: 28,564,249 M354K probably damaging Het
Pax3 T C 1: 78,196,746 T2A probably benign Het
Pcdh17 A G 14: 84,533,520 D1146G probably damaging Het
Pcyt1a T C 16: 32,470,224 probably benign Het
Pfkp C T 13: 6,600,635 G467D possibly damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Pth1r A G 9: 110,731,624 V25A probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Ptprf T A 4: 118,211,022 E1772D probably benign Het
Sall2 T C 14: 52,314,478 H420R probably damaging Het
Sbds G A 5: 130,250,975 R63W probably damaging Het
Sccpdh A G 1: 179,668,410 T19A possibly damaging Het
Scn8a A T 15: 101,015,691 D988V probably damaging Het
Slamf6 C T 1: 171,934,113 Q34* probably null Het
Slc22a6 T A 19: 8,623,652 I403N probably damaging Het
Sox5 T C 6: 143,835,316 Y574C probably damaging Het
Sptbn5 T A 2: 120,059,416 probably benign Het
Srcap T A 7: 127,538,544 V1022E probably damaging Het
Tbx3 G A 5: 119,677,570 E292K possibly damaging Het
Tbx5 A T 5: 119,841,899 H170L probably damaging Het
Tcf12 A T 9: 71,868,967 probably benign Het
Themis G A 10: 28,782,651 R558H probably damaging Het
Tiam1 T C 16: 89,843,282 E849G possibly damaging Het
Vav3 A G 3: 109,563,218 probably benign Het
Vmn2r90 T A 17: 17,733,694 C707S possibly damaging Het
Vmn2r96 T G 17: 18,583,008 N201K probably benign Het
Zfp148 C T 16: 33,468,135 R207C probably damaging Het
Zfp648 G T 1: 154,204,406 A104S probably benign Het
Other mutations in Adar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Adar APN 3 89730840 critical splice donor site probably null
IGL01743:Adar APN 3 89745440 nonsense probably null
IGL01982:Adar APN 3 89738090 missense probably benign 0.03
logimen UTSW 3 89730814 missense probably benign 0.04
R0153:Adar UTSW 3 89730814 missense probably benign 0.04
R0464:Adar UTSW 3 89735582 missense possibly damaging 0.90
R0674:Adar UTSW 3 89749823 intron probably benign
R0762:Adar UTSW 3 89739983 splice site probably benign
R1567:Adar UTSW 3 89735781 missense probably benign 0.19
R1807:Adar UTSW 3 89734865 missense probably benign 0.00
R1858:Adar UTSW 3 89739282 missense probably benign 0.01
R1964:Adar UTSW 3 89745895 missense probably benign 0.23
R2440:Adar UTSW 3 89734854 missense possibly damaging 0.86
R3731:Adar UTSW 3 89746655 missense probably damaging 0.99
R3854:Adar UTSW 3 89736258 missense probably damaging 1.00
R4005:Adar UTSW 3 89749787 missense probably damaging 1.00
R4105:Adar UTSW 3 89740094 missense probably benign 0.00
R4980:Adar UTSW 3 89730814 missense probably benign 0.04
R5096:Adar UTSW 3 89747291 makesense probably null
R5199:Adar UTSW 3 89745944 missense probably damaging 1.00
R5397:Adar UTSW 3 89735319 missense probably benign
R5406:Adar UTSW 3 89736111 missense probably damaging 1.00
R5411:Adar UTSW 3 89739212 missense probably benign 0.39
R5446:Adar UTSW 3 89740179 missense probably damaging 1.00
R5660:Adar UTSW 3 89735594 missense probably damaging 1.00
R5724:Adar UTSW 3 89735169 missense probably benign
R6087:Adar UTSW 3 89745590 missense probably benign 0.05
R6935:Adar UTSW 3 89747218 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTACACACAGTGCTCCTGC -3'
(R):5'- AGCTGGCACTCAGTTAGCTTC -3'

Sequencing Primer
(F):5'- ACAGTGCTCCTGCCCCTAC -3'
(R):5'- AGCTTCTTGTAGGGTGAACAC -3'
Posted On2015-10-21