Incidental Mutation 'R4693:Angptl6'
ID355041
Institutional Source Beutler Lab
Gene Symbol Angptl6
Ensembl Gene ENSMUSG00000038742
Gene Nameangiopoietin-like 6
SynonymsAngiopoietin-related growth factor, 6330404E11Rik, Arp5, AGF
MMRRC Submission 041944-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R4693 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20873808-20879727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20875302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 349 (D349E)
Ref Sequence ENSEMBL: ENSMUSP00000035784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043726] [ENSMUST00000043911]
Predicted Effect probably damaging
Transcript: ENSMUST00000043726
AA Change: D349E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035784
Gene: ENSMUSG00000038742
AA Change: D349E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 51 77 N/A INTRINSIC
coiled coil region 126 164 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
FBG 242 455 7.15e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043911
SMART Domains Protein: ENSMUSP00000045384
Gene: ENSMUSG00000038884

DomainStartEndE-ValueType
Pfam:UPF0515 16 272 1.3e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177067
Meta Mutation Damage Score 0.0384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele die around E13 with cardiovascular defects; survivors develop obesity, lipid accumulation in skeletal muscle and liver, hyperglycemia and hyperinsulinemia, and insulin resistance accompanied by reduced energy expenditure and whole-body oxygen consumption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T C 17: 84,696,697 Y478H probably damaging Het
Adar A T 3: 89,735,940 H128L probably damaging Het
Anxa9 T C 3: 95,297,356 T286A probably benign Het
Apobr A G 7: 126,586,847 N510S probably damaging Het
Atoh7 G T 10: 63,100,496 R114L probably benign Het
Bank1 C G 3: 136,247,676 R106P probably damaging Het
Best1 C T 19: 9,997,135 G15D probably damaging Het
Best2 A T 8: 85,011,203 F188I probably damaging Het
Ccdc88a T C 11: 29,482,241 Y344H probably damaging Het
Col6a5 A G 9: 105,937,172 L547P unknown Het
Cyp19a1 A T 9: 54,173,333 S247T possibly damaging Het
Cyp26a1 T C 19: 37,698,477 S126P probably benign Het
Dab1 G T 4: 104,679,553 C180F probably damaging Het
Dclk2 T C 3: 86,815,093 D412G possibly damaging Het
Dspp A T 5: 104,178,062 S764C unknown Het
Dync1li1 C A 9: 114,706,098 D143E probably damaging Het
Esm1 A T 13: 113,210,060 D73V probably damaging Het
Etfdh A T 3: 79,605,803 V431E probably damaging Het
Fam83c C T 2: 155,830,234 R427H probably damaging Het
Galnt9 A G 5: 110,615,509 Y93C probably damaging Het
Gm6818 G A 7: 38,400,702 noncoding transcript Het
Gm884 T A 11: 103,619,860 E427D unknown Het
Gm8979 T G 7: 106,082,378 noncoding transcript Het
Gosr2 A G 11: 103,683,929 S114P probably benign Het
Grip1 G A 10: 120,000,554 V444I probably benign Het
Haus4 G T 14: 54,549,799 A67E probably benign Het
Hectd2 T A 19: 36,614,338 probably benign Het
Kndc1 T C 7: 139,921,779 Y911H probably benign Het
Lim2 T C 7: 43,430,681 Y31H probably damaging Het
Lims2 G A 18: 31,944,499 R101H probably benign Het
Lrrc2 T A 9: 110,970,093 M236K probably damaging Het
Lrrk1 T C 7: 66,262,487 Y1775C probably damaging Het
Mdga2 A G 12: 66,797,633 V197A possibly damaging Het
Mfhas1 T A 8: 35,589,175 L268Q probably damaging Het
Mlh1 A G 9: 111,255,658 I216T probably damaging Het
Mrc2 G A 11: 105,343,702 C1016Y probably benign Het
Mvp C A 7: 126,998,328 V168F probably damaging Het
Mybphl A G 3: 108,375,178 T176A probably benign Het
Myt1 T A 2: 181,795,739 L81Q probably damaging Het
Ncbp3 T C 11: 73,075,677 L453S probably benign Het
Olfr1157 A T 2: 87,962,709 F61Y probably benign Het
Olfr1219 T C 2: 89,075,068 T8A possibly damaging Het
Olfr1231 T A 2: 89,303,277 E105V probably benign Het
Olfr1456-ps1 C A 19: 13,078,862 noncoding transcript Het
Olfr545 T A 7: 102,494,452 I108F probably damaging Het
Pak4 A T 7: 28,564,249 M354K probably damaging Het
Pax3 T C 1: 78,196,746 T2A probably benign Het
Pcdh17 A G 14: 84,533,520 D1146G probably damaging Het
Pcyt1a T C 16: 32,470,224 probably benign Het
Pfkp C T 13: 6,600,635 G467D possibly damaging Het
Plin4 C A 17: 56,103,762 G1090C probably damaging Het
Pth1r A G 9: 110,731,624 V25A probably damaging Het
Ptk2b C T 14: 66,157,069 G859S probably benign Het
Ptprf T A 4: 118,211,022 E1772D probably benign Het
Sall2 T C 14: 52,314,478 H420R probably damaging Het
Sbds G A 5: 130,250,975 R63W probably damaging Het
Sccpdh A G 1: 179,668,410 T19A possibly damaging Het
Scn8a A T 15: 101,015,691 D988V probably damaging Het
Slamf6 C T 1: 171,934,113 Q34* probably null Het
Slc22a6 T A 19: 8,623,652 I403N probably damaging Het
Sox5 T C 6: 143,835,316 Y574C probably damaging Het
Sptbn5 T A 2: 120,059,416 probably benign Het
Srcap T A 7: 127,538,544 V1022E probably damaging Het
Tbx3 G A 5: 119,677,570 E292K possibly damaging Het
Tbx5 A T 5: 119,841,899 H170L probably damaging Het
Tcf12 A T 9: 71,868,967 probably benign Het
Themis G A 10: 28,782,651 R558H probably damaging Het
Tiam1 T C 16: 89,843,282 E849G possibly damaging Het
Vav3 A G 3: 109,563,218 probably benign Het
Vmn2r90 T A 17: 17,733,694 C707S possibly damaging Het
Vmn2r96 T G 17: 18,583,008 N201K probably benign Het
Zfp148 C T 16: 33,468,135 R207C probably damaging Het
Zfp648 G T 1: 154,204,406 A104S probably benign Het
Other mutations in Angptl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02222:Angptl6 APN 9 20873907 missense probably damaging 0.99
IGL02448:Angptl6 APN 9 20875570 missense probably damaging 1.00
IGL03064:Angptl6 APN 9 20875643 nonsense probably null
R0137:Angptl6 UTSW 9 20878387 missense probably benign 0.00
R0669:Angptl6 UTSW 9 20876527 missense probably damaging 1.00
R1165:Angptl6 UTSW 9 20878308 missense probably benign
R5434:Angptl6 UTSW 9 20875525 missense probably damaging 0.99
R6518:Angptl6 UTSW 9 20875360 missense probably damaging 0.98
R7081:Angptl6 UTSW 9 20875348 missense probably damaging 0.98
R7169:Angptl6 UTSW 9 20875179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACCAGAATAGCAGTCCCG -3'
(R):5'- GCACTACAAGGTGTGTGCTTG -3'

Sequencing Primer
(F):5'- GAATAGCAGTCCCGCCTCC -3'
(R):5'- TGTCAGAGACTGCTGGGC -3'
Posted On2015-10-21