Incidental Mutation 'R4705:Col4a2'
ID355122
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
SynonymsCol4a-2
MMRRC Submission 041953-MU
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4705 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11313504 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 14 (R14Q)
Ref Sequence ENSEMBL: ENSMUSP00000033899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000033899] [ENSMUST00000209735]
Predicted Effect probably benign
Transcript: ENSMUST00000033898
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000033899
AA Change: R14Q

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: R14Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209735
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hdac7 G T 15: 97,811,587 Q21K probably damaging Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0124:Col4a2 UTSW 8 11408871 splice site probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2016:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2124:Col4a2 UTSW 8 11416070 missense probably damaging 1.00
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R3156:Col4a2 UTSW 8 11313414 unclassified probably benign
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4710:Col4a2 UTSW 8 11409462 missense probably benign 0.22
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5221:Col4a2 UTSW 8 11448225 missense probably benign 0.00
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7196:Col4a2 UTSW 8 11398693 missense probably damaging 1.00
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
R7434:Col4a2 UTSW 8 11421250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACTTTGGTCACCCCG -3'
(R):5'- AGTTCAAGCGGTACTTACCCC -3'

Sequencing Primer
(F):5'- CAAGGAAACGAGGGACATTATGC -3'
(R):5'- GTACTTACCCCCAAGACGCTCTG -3'
Posted On2015-10-21