Incidental Mutation 'R4705:Hdac7'
ID355168
Institutional Source Beutler Lab
Gene Symbol Hdac7
Ensembl Gene ENSMUSG00000022475
Gene Namehistone deacetylase 7
SynonymsHdac7a, 5830434K02Rik
MMRRC Submission 041953-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4705 (G1)
Quality Score134
Status Validated
Chromosome15
Chromosomal Location97792664-97844502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97811587 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 21 (Q21K)
Ref Sequence ENSEMBL: ENSMUSP00000120576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079838] [ENSMUST00000088402] [ENSMUST00000116408] [ENSMUST00000116409] [ENSMUST00000118294] [ENSMUST00000119670] [ENSMUST00000120683] [ENSMUST00000121514] [ENSMUST00000156045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079838
AA Change: Q21K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078766
Gene: ENSMUSG00000022475
AA Change: Q21K

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
Pfam:Hist_deacetyl 523 853 2.5e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000088402
AA Change: Q21K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085744
Gene: ENSMUSG00000022475
AA Change: Q21K

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
Pfam:Hist_deacetyl 517 847 2.5e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116408
SMART Domains Protein: ENSMUSP00000112109
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 825 2.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116409
SMART Domains Protein: ENSMUSP00000112110
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Pfam:Hist_deacetyl 532 862 9.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118294
SMART Domains Protein: ENSMUSP00000113380
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
Pfam:Hist_deacetyl 525 855 2.6e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119670
SMART Domains Protein: ENSMUSP00000112459
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 174 189 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
low complexity region 374 386 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
low complexity region 433 446 N/A INTRINSIC
Pfam:Hist_deacetyl 471 801 2.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120683
SMART Domains Protein: ENSMUSP00000112446
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 623 7.9e-9 PFAM
Pfam:Hist_deacetyl 623 777 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121514
SMART Domains Protein: ENSMUSP00000112641
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Pfam:Hist_deacetyl 430 760 9e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134258
SMART Domains Protein: ENSMUSP00000118599
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 52 64 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 111 124 N/A INTRINSIC
PDB:3ZNS|C 127 241 5e-70 PDB
SCOP:d1c3pa_ 139 219 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135651
SMART Domains Protein: ENSMUSP00000119970
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
Pfam:Hist_deacetyl 166 213 8.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156045
AA Change: Q21K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120576
Gene: ENSMUSG00000022475
AA Change: Q21K

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
PDB:3ZNS|C 495 602 2e-60 PDB
SCOP:d1c3pa_ 507 587 6e-16 SMART
low complexity region 603 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228466
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 96% (113/118)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to mouse HDAC7 gene whose protein promotes repression mediated via the transcriptional corepressor SMRT. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of this gene result in embryonic lethality by E11, due to vascular defects which are due to endothelial cell adhesion defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,520,635 N325D possibly damaging Het
1700056E22Rik A G 1: 184,033,172 V230A possibly damaging Het
2010315B03Rik T C 9: 124,294,001 T123A possibly damaging Het
4932438A13Rik C T 3: 37,041,889 T1108I probably benign Het
Abca4 T C 3: 122,105,370 V667A probably damaging Het
Abcb5 A G 12: 118,965,305 S4P possibly damaging Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Ahnak C A 19: 9,016,906 H5185N probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Aspscr1 A T 11: 120,688,945 K39N possibly damaging Het
Atf7ip C T 6: 136,561,194 P483L probably damaging Het
Atp11a C G 8: 12,813,118 P99R probably damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bag6 C A 17: 35,142,343 P476H probably damaging Het
BC049730 T A 7: 24,713,509 L114Q probably damaging Het
C2cd3 A G 7: 100,395,188 K326E possibly damaging Het
Casp1 A G 9: 5,306,204 D363G probably damaging Het
Ccdc33 G T 9: 58,117,557 Q129K probably benign Het
Ccdc88a T C 11: 29,422,586 I107T probably benign Het
Cela2a T C 4: 141,821,411 N138S probably benign Het
Cfap61 A C 2: 146,035,202 R460S probably damaging Het
Clstn2 T C 9: 97,463,559 N579D possibly damaging Het
Col13a1 C A 10: 61,850,165 G683W unknown Het
Col4a2 G A 8: 11,313,504 R14Q possibly damaging Het
Cpa6 A G 1: 10,481,058 S164P probably benign Het
Cpq A G 15: 33,497,338 N408S probably benign Het
Ctnnal1 T C 4: 56,812,579 T690A probably benign Het
Cx3cl1 A T 8: 94,780,207 N280I probably benign Het
Cyp2b19 C T 7: 26,757,292 R36C probably benign Het
Ddx51 T C 5: 110,655,308 V269A probably damaging Het
Dlst G T 12: 85,118,842 probably null Het
Dmkn G C 7: 30,763,981 A20P probably damaging Het
Dnhd1 T C 7: 105,655,741 I330T probably damaging Het
Dock3 G A 9: 107,025,336 H292Y probably damaging Het
Ell A G 8: 70,578,934 D94G possibly damaging Het
Enam T A 5: 88,503,791 L1053* probably null Het
Fcgbp A G 7: 28,107,296 K2230E probably benign Het
Frmd5 G T 2: 121,562,863 probably benign Het
Gas2l1 G A 11: 5,060,867 S654L possibly damaging Het
Gltpd2 G T 11: 70,520,140 E86* probably null Het
Glyat T C 19: 12,651,297 L152P possibly damaging Het
Gm17330 T C 12: 23,968,782 T22A probably damaging Het
Gm9931 T A 1: 147,281,853 noncoding transcript Het
Gpatch1 A T 7: 35,299,305 probably null Het
Gpr4 T C 7: 19,222,894 L247P probably damaging Het
Gtpbp3 G A 8: 71,491,114 E214K probably benign Het
Hivep3 A G 4: 119,872,050 probably benign Het
Hk2 C T 6: 82,739,650 M300I possibly damaging Het
Ighv1-61 T C 12: 115,359,279 Y71C probably damaging Het
Il1f8 T C 2: 24,154,618 V10A probably benign Het
Inpp5f G T 7: 128,663,987 S152I probably damaging Het
Jag1 C A 2: 137,096,309 W257L probably damaging Het
Jak2 T A 19: 29,294,915 N612K possibly damaging Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kbtbd6 A G 14: 79,452,606 D247G probably benign Het
Kif15 A G 9: 122,959,993 probably null Het
Kndc1 A G 7: 139,930,123 T1293A possibly damaging Het
Lpar5 T C 6: 125,082,207 I297T possibly damaging Het
Lpin2 T A 17: 71,232,143 probably benign Het
Mfsd4a A T 1: 132,053,571 L230Q probably damaging Het
Mmp8 T C 9: 7,565,549 V313A probably benign Het
Mrpl19 A T 6: 81,964,285 D98E probably damaging Het
Mybl1 A G 1: 9,690,115 I86T probably damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Necab1 T C 4: 15,052,628 T117A probably damaging Het
Nol11 A G 11: 107,184,718 probably benign Het
Nucb2 G A 7: 116,540,027 probably null Het
Nupl1 G T 14: 60,251,215 P19T unknown Het
Odf2 T A 2: 29,904,034 L301Q probably damaging Het
Oit1 T C 14: 8,349,347 E201G probably benign Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr736 A G 14: 50,392,800 I15V probably benign Het
Oog4 T C 4: 143,438,875 Y234C probably benign Het
Papln T C 12: 83,777,208 probably null Het
Paqr6 C T 3: 88,365,929 A76V probably benign Het
Pclo A G 5: 14,676,480 probably benign Het
Pdzd8 T C 19: 59,345,311 T93A possibly damaging Het
Pkdrej A T 15: 85,821,167 Y189* probably null Het
Pknox2 A T 9: 36,923,638 N178K possibly damaging Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plxnd1 A C 6: 115,958,620 L1735R probably damaging Het
Polm T A 11: 5,837,663 D30V possibly damaging Het
Rap1gap2 T A 11: 74,437,439 I100F probably damaging Het
Rasgef1c T A 11: 49,978,467 W414R probably benign Het
Rassf1 A G 9: 107,557,867 D187G probably benign Het
Rhag T C 17: 40,836,438 I397T probably benign Het
Rnft2 A G 5: 118,228,863 F269S probably damaging Het
Rnmt T C 18: 68,314,125 F360S probably damaging Het
Ror2 C T 13: 53,117,297 A329T probably benign Het
Slc4a1 T A 11: 102,356,258 N501I possibly damaging Het
Slc4a7 T A 14: 14,733,856 S89T probably damaging Het
Sptbn1 G A 11: 30,100,660 H2310Y probably benign Het
Tbc1d9b C A 11: 50,140,462 N103K probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tmem100 C T 11: 90,035,563 T72I probably damaging Het
Ttc38 A G 15: 85,852,963 T350A probably benign Het
Ubr4 C T 4: 139,450,529 T3241M probably damaging Het
Unc13d A T 11: 116,073,388 M350K possibly damaging Het
Vit T C 17: 78,625,114 I550T probably damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Zbtb12 T A 17: 34,896,401 H387Q possibly damaging Het
Other mutations in Hdac7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Hdac7 APN 15 97809495 missense probably damaging 0.98
IGL01011:Hdac7 APN 15 97793935 missense possibly damaging 0.83
IGL01361:Hdac7 APN 15 97811442 missense possibly damaging 0.85
IGL01474:Hdac7 APN 15 97797939 critical splice donor site probably null
IGL02314:Hdac7 APN 15 97809004 missense probably damaging 1.00
IGL02379:Hdac7 APN 15 97808385 missense probably damaging 0.99
IGL02665:Hdac7 APN 15 97796957 unclassified probably benign
IGL03010:Hdac7 APN 15 97793929 critical splice donor site probably null
IGL03023:Hdac7 APN 15 97797957 missense probably damaging 1.00
IGL03081:Hdac7 APN 15 97798306 missense probably damaging 1.00
Cairn UTSW 15 97808495 frame shift probably null
Signpost UTSW 15 97802747 missense probably damaging 1.00
R0285:Hdac7 UTSW 15 97798222 critical splice donor site probably null
R0518:Hdac7 UTSW 15 97806499 nonsense probably null
R0521:Hdac7 UTSW 15 97806499 nonsense probably null
R0522:Hdac7 UTSW 15 97806679 splice site probably null
R1543:Hdac7 UTSW 15 97809529 splice site probably benign
R1623:Hdac7 UTSW 15 97808404 nonsense probably null
R1665:Hdac7 UTSW 15 97806525 missense probably damaging 1.00
R1844:Hdac7 UTSW 15 97807976 missense probably damaging 0.98
R1895:Hdac7 UTSW 15 97796886 missense probably damaging 1.00
R1975:Hdac7 UTSW 15 97806505 nonsense probably null
R1976:Hdac7 UTSW 15 97806505 nonsense probably null
R2038:Hdac7 UTSW 15 97798270 missense probably damaging 1.00
R2155:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2156:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2263:Hdac7 UTSW 15 97810851 critical splice donor site probably null
R3546:Hdac7 UTSW 15 97808009 missense probably damaging 1.00
R4438:Hdac7 UTSW 15 97807715 missense probably damaging 1.00
R4642:Hdac7 UTSW 15 97806516 missense probably damaging 1.00
R4704:Hdac7 UTSW 15 97796216 missense probably damaging 1.00
R5303:Hdac7 UTSW 15 97798018 missense probably damaging 0.97
R5577:Hdac7 UTSW 15 97811455 missense probably benign 0.09
R5966:Hdac7 UTSW 15 97802491 missense probably damaging 1.00
R5974:Hdac7 UTSW 15 97802072 splice site probably null
R6270:Hdac7 UTSW 15 97808495 frame shift probably null
R6384:Hdac7 UTSW 15 97811506 nonsense probably null
R6835:Hdac7 UTSW 15 97802747 missense probably damaging 1.00
R6869:Hdac7 UTSW 15 97796176 missense probably damaging 1.00
X0028:Hdac7 UTSW 15 97809008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGGGCAATCTGTCTTTACC -3'
(R):5'- TAGACCTCCTTTCCCACAGG -3'

Sequencing Primer
(F):5'- GGCAATCTGTCTTTACCCTCATGG -3'
(R):5'- TCCTTTCCCACAGGTAGAATGGAAG -3'
Posted On2015-10-21