Incidental Mutation 'R4706:Sec24d'
ID355203
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
MMRRC Submission 041954-MU
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4706 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123355778 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 811 (N811K)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047923
AA Change: N811K

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: N811K

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200309
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,279 M353K probably benign Het
Abca16 T A 7: 120,465,765 N548K probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Afap1l2 A T 19: 56,937,240 I152N possibly damaging Het
Ankrd52 T G 10: 128,378,161 M62R probably benign Het
Aox4 A T 1: 58,266,787 T1317S probably damaging Het
Apol7c T A 15: 77,525,723 Q341L probably benign Het
Arhgef4 C T 1: 34,732,217 R1202W probably benign Het
B4galnt2 C T 11: 95,876,097 probably null Het
BC049762 A T 11: 51,253,841 F204L possibly damaging Het
Cecr2 A T 6: 120,755,578 E477V possibly damaging Het
Chmp7 A T 14: 69,718,561 D419E probably benign Het
Cmip A C 8: 117,377,154 K127T probably damaging Het
Csmd2 T C 4: 128,544,751 V3041A probably benign Het
Cyp1b1 T A 17: 79,713,342 I324F possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Ddx10 T C 9: 53,233,931 T249A probably damaging Het
Dscaml1 T C 9: 45,450,580 Y213H probably damaging Het
Eef1a2 T C 2: 181,155,357 D17G probably damaging Het
Fbn1 T C 2: 125,370,149 I848V probably benign Het
Fbxw18 A G 9: 109,690,517 I307T probably benign Het
Fxr1 T A 3: 34,064,129 D500E probably damaging Het
Gars G A 6: 55,069,378 G492D probably damaging Het
Gria2 A T 3: 80,740,990 D146E probably benign Het
Gstz1 A G 12: 87,159,120 N37S probably benign Het
Hnrnph3 C A 10: 63,017,280 G194V probably damaging Het
Il2rb T C 15: 78,486,400 R172G possibly damaging Het
Itga11 T A 9: 62,755,296 V517D possibly damaging Het
Kcnq4 A G 4: 120,704,486 I462T probably benign Het
Klf6 T A 13: 5,861,640 M1K probably null Het
Lrp8 G A 4: 107,861,273 A817T probably benign Het
Map3k5 T A 10: 20,058,938 Y509N probably damaging Het
Mdc1 C T 17: 35,852,779 S1073F probably damaging Het
Mme A G 3: 63,348,712 D531G possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mroh7 A T 4: 106,691,624 V1014E possibly damaging Het
Myo1d C T 11: 80,666,641 C491Y probably damaging Het
Ncoa3 C A 2: 166,047,879 D61E probably damaging Het
Nmrk1 A G 19: 18,645,127 E190G probably benign Het
Nr4a2 G T 2: 57,112,213 P13H probably damaging Het
Nup205 T C 6: 35,202,008 L671P probably damaging Het
Olfr1058 G A 2: 86,386,388 T10I probably benign Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr429 A G 1: 174,089,702 I221V probably damaging Het
Olfr568 T A 7: 102,877,433 H104Q probably damaging Het
Omt2a T C 9: 78,313,070 I16V probably benign Het
Osbpl9 A T 4: 109,156,687 I70N probably damaging Het
Pclo A T 5: 14,714,207 L4231F unknown Het
Per1 C T 11: 69,100,618 probably benign Het
Perm1 G T 4: 156,217,074 C25F probably damaging Het
Phf3 A G 1: 30,805,606 V1424A probably damaging Het
Plxnb1 T G 9: 109,112,028 L1625R probably damaging Het
Ppid G A 3: 79,599,052 V216I probably benign Het
Ppp4r3a C T 12: 101,041,916 G754D probably damaging Het
Prex2 G T 1: 11,199,988 W1299L probably damaging Het
Ptprn2 C A 12: 116,872,094 Q350K probably benign Het
Ralyl G A 3: 14,039,790 probably null Het
Rbm8a G A 3: 96,630,052 probably benign Het
Ros1 A G 10: 52,101,894 S1419P possibly damaging Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rtel1 T C 2: 181,323,746 probably null Het
Sacs A G 14: 61,204,273 E1256G probably damaging Het
Sec23a A G 12: 58,982,586 V467A probably damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shisa5 T A 9: 109,056,060 C133S probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a31 G A 3: 40,716,545 A89T probably damaging Het
Slc6a1 G T 6: 114,307,752 R257L possibly damaging Het
Sntb1 C T 15: 55,749,274 V303M probably benign Het
Snx20 A G 8: 88,627,811 V97A probably damaging Het
Vmn1r29 T A 6: 58,308,151 N285K probably benign Het
Vmn2r98 T G 17: 19,069,745 S514R probably damaging Het
Zfp28 A T 7: 6,389,794 E156D probably damaging Het
Zfp39 A G 11: 58,902,807 V35A probably benign Het
Zfp536 A C 7: 37,569,466 I175S probably damaging Het
Zic5 A T 14: 122,459,557 S549T unknown Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTAGACCAGTGTCCCTCTTTGC -3'
(R):5'- TCCGAGCATATTGTGACATTTCTC -3'

Sequencing Primer
(F):5'- TTTGCCTAGATCACACTACTCAAAAG -3'
(R):5'- AATGACAGCTCAGGACAG -3'
Posted On2015-10-21