Incidental Mutation 'R0211:Itgad'
ID35530
Institutional Source Beutler Lab
Gene Symbol Itgad
Ensembl Gene ENSMUSG00000070369
Gene Nameintegrin, alpha D
SynonymsCd11d
MMRRC Submission 038462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0211 (G1)
Quality Score170
Status Not validated
Chromosome7
Chromosomal Location128154376-128223816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128204641 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 69 (Y69C)
Ref Sequence ENSEMBL: ENSMUSP00000135104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033049] [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000176249] [ENSMUST00000177111] [ENSMUST00000177383]
Predicted Effect probably benign
Transcript: ENSMUST00000033049
SMART Domains Protein: ENSMUSP00000033049
Gene: ENSMUSG00000030785

DomainStartEndE-ValueType
Pfam:COX6A 10 90 4.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000033051
AA Change: Y1164C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: Y1164C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 376 1.24e-36 SMART
Blast:VWA 405 436 1e-9 BLAST
Int_alpha 443 492 3.67e-3 SMART
Int_alpha 496 553 1.03e-6 SMART
Int_alpha 559 615 1.73e-13 SMART
Int_alpha 622 676 1.69e-2 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Pfam:Integrin_alpha 1165 1179 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106237
AA Change: Y1130C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369
AA Change: Y1130C

DomainStartEndE-ValueType
Int_alpha 40 90 1.35e1 SMART
VWA 157 342 1.31e-44 SMART
Blast:VWA 371 402 9e-10 BLAST
Int_alpha 409 458 3.67e-3 SMART
Int_alpha 462 519 1.03e-6 SMART
Int_alpha 525 581 1.73e-13 SMART
Int_alpha 588 642 1.69e-2 SMART
transmembrane domain 1108 1130 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 4.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176249
AA Change: Y62C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135309
Gene: ENSMUSG00000070369
AA Change: Y62C

DomainStartEndE-ValueType
PDB:3K72|C 1 37 5e-11 PDB
transmembrane domain 40 62 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177111
AA Change: Y1128C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: Y1128C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 340 1.31e-44 SMART
Blast:VWA 369 400 9e-10 BLAST
Int_alpha 407 456 3.67e-3 SMART
Int_alpha 460 517 1.03e-6 SMART
Int_alpha 523 579 1.73e-13 SMART
Int_alpha 586 640 1.69e-2 SMART
transmembrane domain 1106 1128 N/A INTRINSIC
Pfam:Integrin_alpha 1129 1143 5.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177383
AA Change: Y69C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135104
Gene: ENSMUSG00000070369
AA Change: Y69C

DomainStartEndE-ValueType
PDB:3K72|C 2 34 1e-9 PDB
transmembrane domain 47 69 N/A INTRINSIC
Pfam:Integrin_alpha 70 84 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205646
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,216,096 L1401P possibly damaging Het
4930503B20Rik C T 3: 146,650,496 R219H probably benign Het
Abcc9 T A 6: 142,688,984 I185F probably benign Het
Adgrf1 T C 17: 43,296,690 L100P probably damaging Het
Akt1 T C 12: 112,655,142 T407A probably damaging Het
Alk C T 17: 72,603,516 R65H probably damaging Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Arhgef12 G A 9: 42,972,004 R1411C probably damaging Het
Arnt T A 3: 95,476,149 M242K probably damaging Het
Atad5 T G 11: 80,095,647 V520G probably benign Het
Avpr1a T A 10: 122,449,469 M222K possibly damaging Het
Cbr2 T A 11: 120,730,788 I88L probably benign Het
Cc2d2a T A 5: 43,688,266 probably null Het
Ccdc51 T C 9: 109,089,373 M10T probably benign Het
Cntnap5b T A 1: 100,478,374 D1136E possibly damaging Het
Coil T A 11: 88,982,153 S447T probably damaging Het
Cryba1 T A 11: 77,718,867 Y179F probably damaging Het
Dcaf4 T A 12: 83,535,961 F277I probably damaging Het
Ddost G A 4: 138,309,602 V159M probably damaging Het
Dnajb6 T C 5: 29,785,079 probably benign Het
Dnase2a A G 8: 84,908,788 probably benign Het
Dscam T C 16: 96,716,079 I877V possibly damaging Het
Dyx1c1 A T 9: 72,961,367 R127S possibly damaging Het
Efcc1 A T 6: 87,749,154 T312S probably benign Het
Ermard A T 17: 15,021,943 Q127L probably damaging Het
F2 T C 2: 91,630,158 E329G probably damaging Het
Foxc2 T A 8: 121,116,616 M1K probably null Het
Fuz T A 7: 44,899,022 probably null Het
Ggnbp2 G A 11: 84,840,313 T325M probably damaging Het
Gm6408 T A 5: 146,483,060 F115I probably benign Het
Gm8909 T C 17: 36,168,007 T117A probably damaging Het
Gp6 C T 7: 4,373,209 probably null Het
Grin2a A G 16: 9,579,173 S1017P possibly damaging Het
Hmmr A T 11: 40,714,808 M318K probably damaging Het
Ifi205 T C 1: 174,028,428 E12G probably benign Het
Ift74 C T 4: 94,679,255 T395I probably benign Het
Ikbkap T A 4: 56,795,545 I143F probably damaging Het
Irf8 A T 8: 120,739,975 D53V probably damaging Het
Itpr2 C A 6: 146,194,613 R2084L probably benign Het
Krt4 C A 15: 101,922,782 S228I possibly damaging Het
Lpin3 A T 2: 160,898,681 D382V probably damaging Het
Ltbp3 T C 19: 5,752,143 probably null Het
Map4k3 C T 17: 80,644,841 A179T probably damaging Het
Nck1 A T 9: 100,497,767 W144R probably damaging Het
Ndufb9 A T 15: 58,939,282 Q139L possibly damaging Het
Ngfr T G 11: 95,571,912 E300A probably damaging Het
Nin T G 12: 70,014,875 T2072P probably damaging Het
Nop2 T G 6: 125,141,344 L529R probably damaging Het
Nrm T A 17: 35,864,611 L203Q probably damaging Het
Nynrin T C 14: 55,871,798 F1454S probably benign Het
Olfr1062 A C 2: 86,423,107 S190A probably damaging Het
Olfr1328 T A 4: 118,934,270 M191L probably benign Het
Olfr1453 T C 19: 13,028,282 T16A possibly damaging Het
Os9 A G 10: 127,121,036 V27A probably damaging Het
Osbpl9 T G 4: 109,073,124 T332P probably damaging Het
Pcdhb10 A T 18: 37,414,006 M712L probably benign Het
Pcx C T 19: 4,620,199 A935V probably damaging Het
Pdzd7 A G 19: 45,033,667 V514A possibly damaging Het
Plin4 C T 17: 56,102,242 G1326D probably damaging Het
Plxnb1 T A 9: 109,103,663 Y568* probably null Het
Pmfbp1 T A 8: 109,541,740 V973D probably benign Het
Ppp2r1b T C 9: 50,861,625 V70A probably benign Het
Prkar2b C A 12: 31,972,184 V201L probably benign Het
Rgr T G 14: 37,046,968 T37P probably damaging Het
Ripk3 A T 14: 55,787,918 L63Q probably damaging Het
Rpusd2 A G 2: 119,038,412 S439G probably benign Het
Serac1 T A 17: 6,050,060 R438S possibly damaging Het
Slc19a1 T A 10: 77,038,466 S24T possibly damaging Het
Slc6a21 A C 7: 45,288,243 T653P possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spdef C T 17: 27,714,920 R309H probably damaging Het
Srp68 A T 11: 116,265,551 Y84N probably damaging Het
Syne2 A T 12: 76,097,957 Q6299L probably damaging Het
Tmem63b T A 17: 45,661,913 M652L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnk1 A G 11: 69,855,181 V306A probably damaging Het
Tnnc2 T A 2: 164,777,484 I147F probably damaging Het
Tnni3k C T 3: 155,055,344 probably benign Het
Togaram2 T A 17: 71,729,248 V911D probably damaging Het
Tyw3 T C 3: 154,587,495 N181S probably damaging Het
Unc79 T A 12: 103,072,792 S682T probably benign Het
Vps13d A G 4: 145,114,778 L2634S probably benign Het
Wasl G T 6: 24,633,893 A124E probably damaging Het
Zfp287 T C 11: 62,714,917 H388R probably damaging Het
Zfp335 T C 2: 164,907,692 T262A probably damaging Het
Zfp457 C G 13: 67,293,147 G359R probably benign Het
Zfp536 T A 7: 37,568,449 E514V probably damaging Het
Zfp872 T A 9: 22,200,173 I316N probably damaging Het
Other mutations in Itgad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Itgad APN 7 128203850 missense probably damaging 0.99
IGL02036:Itgad APN 7 128189821 missense possibly damaging 0.49
IGL02589:Itgad APN 7 128181711 missense probably damaging 1.00
IGL02648:Itgad APN 7 128183374 intron probably benign
IGL02735:Itgad APN 7 128193716 missense probably damaging 1.00
IGL03088:Itgad APN 7 128203032 missense probably benign 0.01
IGL03110:Itgad APN 7 128185985 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0184:Itgad UTSW 7 128189231 missense probably benign 0.02
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0282:Itgad UTSW 7 128189978 splice site probably benign
R0326:Itgad UTSW 7 128198378 missense probably benign 0.00
R0646:Itgad UTSW 7 128174004 missense possibly damaging 0.89
R0947:Itgad UTSW 7 128175693 missense probably benign 0.08
R1439:Itgad UTSW 7 128183006 missense probably benign 0.44
R1454:Itgad UTSW 7 128192137 missense probably benign 0.02
R1503:Itgad UTSW 7 128198121 missense probably benign 0.00
R1531:Itgad UTSW 7 128178370 missense probably benign 0.00
R1572:Itgad UTSW 7 128203234 missense probably damaging 1.00
R1602:Itgad UTSW 7 128190939 missense probably damaging 1.00
R1732:Itgad UTSW 7 128205107 missense probably benign
R2278:Itgad UTSW 7 128205170 missense possibly damaging 0.93
R2851:Itgad UTSW 7 128204560 missense probably benign 0.01
R3029:Itgad UTSW 7 128178371 missense possibly damaging 0.85
R3080:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R3150:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3176:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3177:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3276:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3277:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3833:Itgad UTSW 7 128186233 missense probably damaging 1.00
R4541:Itgad UTSW 7 128198115 missense probably benign 0.13
R4649:Itgad UTSW 7 128189531 missense probably benign 0.01
R4753:Itgad UTSW 7 128223703 makesense probably null
R4852:Itgad UTSW 7 128198530 missense probably damaging 1.00
R4931:Itgad UTSW 7 128204625 missense probably damaging 1.00
R4970:Itgad UTSW 7 128189843 missense possibly damaging 0.70
R5116:Itgad UTSW 7 128203893 missense probably damaging 1.00
R5183:Itgad UTSW 7 128198223 critical splice donor site probably null
R5233:Itgad UTSW 7 128193428 splice site probably null
R5334:Itgad UTSW 7 128189286 missense probably damaging 0.99
R5731:Itgad UTSW 7 128198554 missense probably benign 0.19
R5760:Itgad UTSW 7 128203365 missense probably benign 0.02
R5896:Itgad UTSW 7 128174016 missense probably benign 0.34
R5955:Itgad UTSW 7 128189481 missense probably benign 0.00
R6247:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R6659:Itgad UTSW 7 128185948 missense probably damaging 1.00
R7027:Itgad UTSW 7 128182989 missense probably damaging 1.00
R7104:Itgad UTSW 7 128198378 missense probably benign 0.00
R7120:Itgad UTSW 7 128173974 start codon destroyed probably null 0.02
R7272:Itgad UTSW 7 128205073 missense probably damaging 1.00
R7303:Itgad UTSW 7 128190179 missense probably benign
R7324:Itgad UTSW 7 128189807 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTCATGGGCATTGGCAAGG -3'
(R):5'- AAGCCACAGGCTCATTGTCGGG -3'

Sequencing Primer
(F):5'- gtgtatatgagtgtgtgtgtgg -3'
(R):5'- GCATGTCTGCTTCAGTTTAGC -3'
Posted On2013-05-09