Incidental Mutation 'R4707:Usp34'
ID355347
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Nameubiquitin specific peptidase 34
SynonymsMurr2, A530081C03Rik
MMRRC Submission 041955-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R4707 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23306895-23490560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23487215 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 3326 (L3326S)
Ref Sequence ENSEMBL: ENSMUSP00000137430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020529] [ENSMUST00000109539] [ENSMUST00000129368] [ENSMUST00000147157] [ENSMUST00000180046]
Predicted Effect probably benign
Transcript: ENSMUST00000020529
SMART Domains Protein: ENSMUSP00000020529
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 163 2.52e-57 SMART
Pfam:AHSA1 209 325 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109539
SMART Domains Protein: ENSMUSP00000105166
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 2 115 2.33e-38 SMART
Pfam:AHSA1 161 277 4.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125701
Predicted Effect probably benign
Transcript: ENSMUST00000128372
SMART Domains Protein: ENSMUSP00000121255
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 15 149 2.52e-57 SMART
Pfam:AHSA1 195 311 7.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129368
AA Change: L233S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121426
Gene: ENSMUSG00000056342
AA Change: L233S

DomainStartEndE-ValueType
Blast:Drf_GBD 2 86 1e-19 BLAST
low complexity region 231 244 N/A INTRINSIC
coiled coil region 259 281 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137823
AA Change: L3345S
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: L3345S

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147157
SMART Domains Protein: ENSMUSP00000121920
Gene: ENSMUSG00000020288

DomainStartEndE-ValueType
Aha1_N 29 138 4.15e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153409
Predicted Effect probably damaging
Transcript: ENSMUST00000180046
AA Change: L3326S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: L3326S

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,712 K450R probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Abcf3 A G 16: 20,549,058 K56E possibly damaging Het
Acaca T C 11: 84,312,854 V1477A probably damaging Het
Adamts20 G A 15: 94,333,647 P887L possibly damaging Het
Ahnak T G 19: 9,016,735 S5128A probably benign Het
Ahsa2 C A 11: 23,493,162 V197F probably benign Het
Ak9 C A 10: 41,345,460 H402N probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Ankrd16 A G 2: 11,778,797 D70G probably damaging Het
Apob A T 12: 8,006,205 K1562N probably damaging Het
Arfgap2 C A 2: 91,269,971 S250R probably damaging Het
Arhgef10l C T 4: 140,536,883 M671I possibly damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B4galnt2 C T 11: 95,876,097 probably null Het
C8a A G 4: 104,856,421 Y171H probably damaging Het
Cacnb4 A G 2: 52,474,915 V112A probably benign Het
Capn9 G T 8: 124,613,456 C566F possibly damaging Het
Ccdc88a T A 11: 29,447,956 S230T probably benign Het
Cd300c2 A T 11: 114,996,985 F197Y probably benign Het
Chd5 A G 4: 152,360,582 Y340C probably damaging Het
Chrd A T 16: 20,738,808 I726F possibly damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clasp1 T A 1: 118,543,197 Y197* probably null Het
Cyp2c69 C G 19: 39,849,408 G410A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Dnah5 A T 15: 28,372,375 D2924V probably damaging Het
Efcab12 A T 6: 115,814,549 L554Q possibly damaging Het
Emsy T C 7: 98,597,104 T228A possibly damaging Het
Evc2 G A 5: 37,421,860 V1106I probably benign Het
Exoc8 G T 8: 124,897,470 Q53K possibly damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fbn2 A T 18: 58,056,272 V1594D probably damaging Het
Fer1l4 T C 2: 156,045,623 Y551C possibly damaging Het
Fmnl3 A G 15: 99,323,481 M481T probably benign Het
Fras1 A G 5: 96,735,238 N2543S probably damaging Het
Fsd2 T C 7: 81,559,680 D138G probably damaging Het
Gda C T 19: 21,428,628 V5I probably benign Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Greb1l A G 18: 10,532,922 M830V probably benign Het
Hnrnpul1 A C 7: 25,726,833 V531G probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Igsf3 G C 3: 101,458,094 R1127P probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Islr T C 9: 58,157,687 D179G possibly damaging Het
Jcad G T 18: 4,649,338 E70* probably null Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Mbd5 T C 2: 49,250,156 L44S probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Mgam A T 6: 40,714,632 probably null Het
Mipep T A 14: 60,872,103 I643N probably damaging Het
Mmrn1 A T 6: 60,988,473 I1162L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mug1 G A 6: 121,884,641 C1354Y probably damaging Het
Nbeal2 A T 9: 110,632,055 S1647T probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nedd9 A T 13: 41,338,575 probably null Het
Nr4a2 T A 2: 57,112,093 H116L probably benign Het
Nwd2 A G 5: 63,794,322 Y232C probably damaging Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1197 T A 2: 88,728,712 M296L possibly damaging Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr1284 T A 2: 111,379,645 L215H probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr434 T A 6: 43,216,949 V12D probably benign Het
Olfr58 C T 9: 19,783,300 H18Y probably damaging Het
Olfr938 A G 9: 39,078,262 V161A probably benign Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Prdx6b T C 2: 80,293,060 L71P probably damaging Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptdss1 T C 13: 66,995,418 probably null Het
Pygl T C 12: 70,207,758 T138A possibly damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rev3l T A 10: 39,823,397 S1297T probably damaging Het
Rgma C A 7: 73,417,816 T367K probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rslcan18 A T 13: 67,098,526 C217S probably damaging Het
Rtp3 A G 9: 110,986,211 probably benign Het
Ryr1 A T 7: 29,045,662 N3848K probably damaging Het
Sema6a T A 18: 47,248,712 T923S probably benign Het
Serpinb6d A T 13: 33,671,353 T337S possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sidt1 A T 16: 44,269,858 Y369* probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a17 A C 15: 81,327,326 L163W probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sptbn1 T C 11: 30,137,197 T1081A possibly damaging Het
Sptbn4 T C 7: 27,417,006 D456G probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r118 T A 6: 23,969,226 M279L probably benign Het
Tc2n T G 12: 101,694,573 Q133H probably benign Het
Tctn1 A G 5: 122,261,405 probably null Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tex10 A T 4: 48,468,984 S64T probably benign Het
Tex15 A G 8: 33,582,497 T2691A probably benign Het
Tmem175 A T 5: 108,642,150 T123S probably damaging Het
Tsc1 C A 2: 28,672,407 S348R probably damaging Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttll8 A T 15: 88,917,090 I465N probably damaging Het
Ubr3 A G 2: 69,938,370 probably benign Het
Ugdh A T 5: 65,423,352 probably null Het
Vmn2r125 A T 4: 156,349,981 I21F probably damaging Het
Vps9d1 G A 8: 123,248,612 probably benign Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zbtb12 T C 17: 34,895,499 S87P probably damaging Het
Zc3h12a A G 4: 125,120,893 M266T probably damaging Het
Zfp108 G A 7: 24,260,412 A143T probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 synonymous probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7358:Usp34 UTSW 11 23361683 missense probably damaging 0.99
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7459:Usp34 UTSW 11 23364458 missense possibly damaging 0.53
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGCTCTTCTGAAATGTCATTTCTGC -3'
(R):5'- TCAGTCTTACGTTCTCAGTACTGG -3'

Sequencing Primer
(F):5'- AGGATTTGTTTTGTGCATGTACAC -3'
(R):5'- CGTTCTCAGTACTGGAAAATATGTGC -3'
Posted On2015-10-21