Incidental Mutation 'R4707:Apob'
ID355359
Institutional Source Beutler Lab
Gene Symbol Apob
Ensembl Gene ENSMUSG00000020609
Gene Nameapolipoprotein B
Synonymsapob-100, apob-48
MMRRC Submission 041955-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R4707 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location7977648-8016835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8006205 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1562 (K1562N)
Ref Sequence ENSEMBL: ENSMUSP00000036044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811]
Predicted Effect probably benign
Transcript: ENSMUST00000037520
AA Change: K1529N

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: K1529N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 33 585 6.03e-94 SMART
DUF1943 619 932 7.88e-97 SMART
Pfam:DUF1081 945 1059 9.4e-32 PFAM
low complexity region 1100 1109 N/A INTRINSIC
Blast:LPD_N 1249 1311 9e-22 BLAST
low complexity region 1632 1644 N/A INTRINSIC
internal_repeat_1 1882 2038 6.61e-9 PROSPERO
SCOP:d1gw5a_ 2105 2577 9e-5 SMART
internal_repeat_1 2973 3150 6.61e-9 PROSPERO
low complexity region 3561 3580 N/A INTRINSIC
low complexity region 3928 3936 N/A INTRINSIC
Pfam:ApoB100_C 4401 4456 5.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000037811
AA Change: K1562N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: K1562N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LPD_N 46 598 6.03e-94 SMART
DUF1943 632 945 7.88e-97 SMART
Pfam:DUF1081 960 1070 6.3e-39 PFAM
low complexity region 1113 1122 N/A INTRINSIC
Blast:LPD_N 1282 1344 1e-21 BLAST
low complexity region 1665 1677 N/A INTRINSIC
internal_repeat_1 1915 2071 6.6e-9 PROSPERO
SCOP:d1gw5a_ 2138 2610 9e-5 SMART
internal_repeat_1 3006 3183 6.6e-9 PROSPERO
low complexity region 3594 3613 N/A INTRINSIC
low complexity region 3961 3969 N/A INTRINSIC
Pfam:ApoB100_C 4434 4490 1.6e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,712 K450R probably damaging Het
Abcd2 T C 15: 91,159,182 D601G probably benign Het
Abcf3 A G 16: 20,549,058 K56E possibly damaging Het
Acaca T C 11: 84,312,854 V1477A probably damaging Het
Adamts20 G A 15: 94,333,647 P887L possibly damaging Het
Ahnak T G 19: 9,016,735 S5128A probably benign Het
Ahsa2 C A 11: 23,493,162 V197F probably benign Het
Ak9 C A 10: 41,345,460 H402N probably benign Het
Alpk1 G T 3: 127,687,592 N175K possibly damaging Het
Als2 A G 1: 59,215,313 V295A probably benign Het
Ankrd16 A G 2: 11,778,797 D70G probably damaging Het
Arfgap2 C A 2: 91,269,971 S250R probably damaging Het
Arhgef10l C T 4: 140,536,883 M671I possibly damaging Het
Atrnl1 A G 19: 57,629,158 I122V probably damaging Het
B4galnt2 C T 11: 95,876,097 probably null Het
C8a A G 4: 104,856,421 Y171H probably damaging Het
Cacnb4 A G 2: 52,474,915 V112A probably benign Het
Capn9 G T 8: 124,613,456 C566F possibly damaging Het
Ccdc88a T A 11: 29,447,956 S230T probably benign Het
Cd300c2 A T 11: 114,996,985 F197Y probably benign Het
Chd5 A G 4: 152,360,582 Y340C probably damaging Het
Chrd A T 16: 20,738,808 I726F possibly damaging Het
Chrna10 G A 7: 102,113,219 P255S possibly damaging Het
Clasp1 T A 1: 118,543,197 Y197* probably null Het
Cyp2c69 C G 19: 39,849,408 G410A probably benign Het
Cyp2e1 G A 7: 140,763,908 V20I possibly damaging Het
Dapp1 T C 3: 137,933,167 D225G probably benign Het
Dnah5 A T 15: 28,372,375 D2924V probably damaging Het
Efcab12 A T 6: 115,814,549 L554Q possibly damaging Het
Emsy T C 7: 98,597,104 T228A possibly damaging Het
Evc2 G A 5: 37,421,860 V1106I probably benign Het
Exoc8 G T 8: 124,897,470 Q53K possibly damaging Het
Fam160a1 G T 3: 85,688,570 T115K probably damaging Het
Fbn2 A T 18: 58,056,272 V1594D probably damaging Het
Fer1l4 T C 2: 156,045,623 Y551C possibly damaging Het
Fmnl3 A G 15: 99,323,481 M481T probably benign Het
Fras1 A G 5: 96,735,238 N2543S probably damaging Het
Fsd2 T C 7: 81,559,680 D138G probably damaging Het
Gda C T 19: 21,428,628 V5I probably benign Het
Glt8d2 A T 10: 82,660,749 D158E probably damaging Het
Gpx6 C T 13: 21,312,264 Q3* probably null Het
Greb1l A G 18: 10,532,922 M830V probably benign Het
Hnrnpul1 A C 7: 25,726,833 V531G probably damaging Het
Ifi206 A T 1: 173,480,866 H521Q probably benign Het
Igsf3 G C 3: 101,458,094 R1127P probably benign Het
Il1rl1 A G 1: 40,450,188 R367G probably damaging Het
Islr T C 9: 58,157,687 D179G possibly damaging Het
Jcad G T 18: 4,649,338 E70* probably null Het
Kcnd2 T C 6: 21,723,212 I467T probably benign Het
Lrrc27 A G 7: 139,242,698 T502A probably benign Het
Lrrtm3 T A 10: 64,088,002 H462L probably benign Het
Mbd5 T C 2: 49,250,156 L44S probably damaging Het
Mccc1 C A 3: 35,975,873 M429I probably damaging Het
Mgam A T 6: 40,714,632 probably null Het
Mipep T A 14: 60,872,103 I643N probably damaging Het
Mmrn1 A T 6: 60,988,473 I1162L probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Mug1 G A 6: 121,884,641 C1354Y probably damaging Het
Nbeal2 A T 9: 110,632,055 S1647T probably benign Het
Ndufaf2 C G 13: 108,052,780 A145P probably damaging Het
Nedd9 A T 13: 41,338,575 probably null Het
Nr4a2 T A 2: 57,112,093 H116L probably benign Het
Nwd2 A G 5: 63,794,322 Y232C probably damaging Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1197 T A 2: 88,728,712 M296L possibly damaging Het
Olfr1221 A T 2: 89,112,232 F93L probably damaging Het
Olfr1284 T A 2: 111,379,645 L215H probably damaging Het
Olfr284 G T 15: 98,340,778 H70Q possibly damaging Het
Olfr434 T A 6: 43,216,949 V12D probably benign Het
Olfr58 C T 9: 19,783,300 H18Y probably damaging Het
Olfr938 A G 9: 39,078,262 V161A probably benign Het
Orc6 T A 8: 85,302,950 I41K probably damaging Het
Pikfyve A G 1: 65,267,846 T1798A probably benign Het
Prdx6b T C 2: 80,293,060 L71P probably damaging Het
Prmt2 A G 10: 76,226,221 I50T probably damaging Het
Ptdss1 T C 13: 66,995,418 probably null Het
Pygl T C 12: 70,207,758 T138A possibly damaging Het
Rab3c T C 13: 110,061,900 E198G probably benign Het
Rbl2 A G 8: 91,085,568 Y255C probably damaging Het
Rev3l T A 10: 39,823,397 S1297T probably damaging Het
Rgma C A 7: 73,417,816 T367K probably damaging Het
Rps6ka5 C T 12: 100,597,885 probably null Het
Rslcan18 A T 13: 67,098,526 C217S probably damaging Het
Rtp3 A G 9: 110,986,211 probably benign Het
Ryr1 A T 7: 29,045,662 N3848K probably damaging Het
Sema6a T A 18: 47,248,712 T923S probably benign Het
Serpinb6d A T 13: 33,671,353 T337S possibly damaging Het
Sf3b1 G A 1: 54,990,507 T1112M probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sidt1 A T 16: 44,269,858 Y369* probably null Het
Slc16a6 A G 11: 109,463,367 S59P probably benign Het
Slc25a17 A C 15: 81,327,326 L163W probably damaging Het
Slc44a3 T C 3: 121,527,074 T93A possibly damaging Het
Sptbn1 T C 11: 30,137,197 T1081A possibly damaging Het
Sptbn4 T C 7: 27,417,006 D456G probably benign Het
Sycp1 C A 3: 102,853,489 A703S possibly damaging Het
Tas2r118 T A 6: 23,969,226 M279L probably benign Het
Tc2n T G 12: 101,694,573 Q133H probably benign Het
Tctn1 A G 5: 122,261,405 probably null Het
Tenm4 A C 7: 96,774,046 K683Q probably damaging Het
Tex10 A T 4: 48,468,984 S64T probably benign Het
Tex15 A G 8: 33,582,497 T2691A probably benign Het
Tmem175 A T 5: 108,642,150 T123S probably damaging Het
Tsc1 C A 2: 28,672,407 S348R probably damaging Het
Ttll4 A T 1: 74,679,007 T6S possibly damaging Het
Ttll8 A T 15: 88,917,090 I465N probably damaging Het
Ubr3 A G 2: 69,938,370 probably benign Het
Ugdh A T 5: 65,423,352 probably null Het
Usp34 T C 11: 23,487,215 L3326S probably damaging Het
Vmn2r125 A T 4: 156,349,981 I21F probably damaging Het
Vps9d1 G A 8: 123,248,612 probably benign Het
Xab2 G A 8: 3,618,117 R154C possibly damaging Het
Zbtb12 T C 17: 34,895,499 S87P probably damaging Het
Zc3h12a A G 4: 125,120,893 M266T probably damaging Het
Zfp108 G A 7: 24,260,412 A143T probably benign Het
Other mutations in Apob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Apob APN 12 7993065 splice site probably benign
IGL00421:Apob APN 12 8010197 missense probably damaging 0.99
IGL00658:Apob APN 12 8009471 missense probably benign 0.08
IGL00768:Apob APN 12 8002107 missense probably damaging 1.00
IGL00833:Apob APN 12 8010101 missense probably benign 0.14
IGL00926:Apob APN 12 8015421 missense probably benign 0.01
IGL01065:Apob APN 12 8003299 missense probably damaging 0.99
IGL01313:Apob APN 12 8000898 missense probably damaging 1.00
IGL01419:Apob APN 12 8002251 missense probably damaging 0.99
IGL01461:Apob APN 12 8001884 missense probably benign 0.13
IGL02002:Apob APN 12 7994822 missense probably benign 0.03
IGL02031:Apob APN 12 8015222 missense probably benign
IGL02102:Apob APN 12 7989407 missense possibly damaging 0.94
IGL02115:Apob APN 12 7992923 missense probably benign 0.06
IGL02513:Apob APN 12 7992979 missense probably benign 0.01
IGL02967:Apob APN 12 8015366 nonsense probably null
IGL03005:Apob APN 12 7993059 splice site probably benign
IGL03011:Apob APN 12 7997883 missense probably damaging 1.00
IGL03116:Apob APN 12 8016350 missense probably damaging 0.98
IGL03215:Apob APN 12 8013818 missense possibly damaging 0.92
IGL03227:Apob APN 12 8016089 missense probably benign 0.04
essence UTSW 12 8007769 nonsense probably null
Ethos UTSW 12 7990394 missense probably null 1.00
IGL02835:Apob UTSW 12 8015097 missense possibly damaging 0.86
IGL02837:Apob UTSW 12 8005102 missense probably damaging 1.00
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0071:Apob UTSW 12 8002111 missense probably damaging 0.98
R0116:Apob UTSW 12 7989113 unclassified probably benign
R0180:Apob UTSW 12 8008285 nonsense probably null
R0288:Apob UTSW 12 7990779 nonsense probably null
R0295:Apob UTSW 12 8002181 nonsense probably null
R0305:Apob UTSW 12 8012210 missense probably damaging 1.00
R0312:Apob UTSW 12 8009034 missense probably benign
R0324:Apob UTSW 12 8010521 missense probably benign 0.41
R0326:Apob UTSW 12 7990307 missense probably damaging 1.00
R0363:Apob UTSW 12 8010136 missense probably damaging 1.00
R0390:Apob UTSW 12 7988678 missense probably damaging 0.99
R0462:Apob UTSW 12 8000896 missense probably damaging 1.00
R0471:Apob UTSW 12 7990406 missense probably damaging 1.00
R0532:Apob UTSW 12 8016188 missense possibly damaging 0.48
R0548:Apob UTSW 12 8006282 missense probably damaging 1.00
R0560:Apob UTSW 12 8005101 missense probably damaging 1.00
R0595:Apob UTSW 12 8008369 missense probably benign 0.01
R0600:Apob UTSW 12 8006440 missense probably damaging 1.00
R0626:Apob UTSW 12 8016193 missense probably benign 0.45
R0685:Apob UTSW 12 8010742 missense probably benign
R0765:Apob UTSW 12 8016518 missense probably benign
R0790:Apob UTSW 12 8010245 missense probably damaging 1.00
R0918:Apob UTSW 12 7983941 missense probably benign 0.10
R0962:Apob UTSW 12 7989191 missense probably damaging 0.98
R1055:Apob UTSW 12 7994963 missense probably damaging 1.00
R1077:Apob UTSW 12 8006017 missense probably benign
R1143:Apob UTSW 12 8012354 missense probably benign 0.26
R1163:Apob UTSW 12 8011654 missense probably damaging 1.00
R1266:Apob UTSW 12 8006093 missense probably benign 0.37
R1434:Apob UTSW 12 8009715 missense probably damaging 1.00
R1442:Apob UTSW 12 7986165 missense probably benign 0.31
R1445:Apob UTSW 12 8016084 missense possibly damaging 0.48
R1459:Apob UTSW 12 8006047 missense probably benign
R1459:Apob UTSW 12 8011937 missense possibly damaging 0.92
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1465:Apob UTSW 12 8011421 missense possibly damaging 0.91
R1508:Apob UTSW 12 8011481 missense possibly damaging 0.92
R1518:Apob UTSW 12 7989207 missense probably benign 0.01
R1531:Apob UTSW 12 7997880 missense possibly damaging 0.65
R1547:Apob UTSW 12 8003368 missense probably benign 0.08
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1574:Apob UTSW 12 7990839 missense possibly damaging 0.51
R1682:Apob UTSW 12 8012365 missense probably benign 0.00
R1709:Apob UTSW 12 8009306 missense probably damaging 0.98
R1718:Apob UTSW 12 8016087 missense probably benign 0.02
R1752:Apob UTSW 12 7988766 missense probably benign 0.01
R1781:Apob UTSW 12 8009603 missense possibly damaging 0.96
R1818:Apob UTSW 12 8006834 missense probably damaging 0.98
R1818:Apob UTSW 12 8013064 missense possibly damaging 0.93
R1842:Apob UTSW 12 8011559 missense probably damaging 1.00
R1843:Apob UTSW 12 8007602 missense possibly damaging 0.65
R1853:Apob UTSW 12 8010928 nonsense probably null
R1990:Apob UTSW 12 8001039 missense probably damaging 1.00
R2016:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2017:Apob UTSW 12 8007751 missense possibly damaging 0.48
R2023:Apob UTSW 12 8011090 missense probably benign 0.01
R2037:Apob UTSW 12 8007488 missense probably benign 0.37
R2054:Apob UTSW 12 8013134 missense probably damaging 1.00
R2057:Apob UTSW 12 8002164 nonsense probably null
R2085:Apob UTSW 12 8012240 missense probably damaging 1.00
R2159:Apob UTSW 12 8010081 missense probably benign 0.12
R2209:Apob UTSW 12 8007752 missense probably benign 0.28
R2249:Apob UTSW 12 8007499 missense probably damaging 1.00
R2254:Apob UTSW 12 8011256 missense possibly damaging 0.92
R2265:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2266:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2267:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2268:Apob UTSW 12 8015475 missense possibly damaging 0.74
R2296:Apob UTSW 12 7994879 missense probably damaging 0.97
R2897:Apob UTSW 12 8010356 missense probably damaging 1.00
R3431:Apob UTSW 12 8010778 missense probably damaging 1.00
R3723:Apob UTSW 12 8006327 missense probably damaging 1.00
R3723:Apob UTSW 12 8011763 missense possibly damaging 0.46
R3899:Apob UTSW 12 8015849 missense possibly damaging 0.87
R4020:Apob UTSW 12 7994914 nonsense probably null
R4050:Apob UTSW 12 8015390 missense probably benign 0.02
R4351:Apob UTSW 12 7993054 missense probably benign 0.03
R4365:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4366:Apob UTSW 12 8016083 missense possibly damaging 0.95
R4456:Apob UTSW 12 8015445 missense probably damaging 1.00
R4458:Apob UTSW 12 8015445 missense probably damaging 1.00
R4600:Apob UTSW 12 8008568 missense probably damaging 1.00
R4611:Apob UTSW 12 8011331 missense probably damaging 1.00
R4646:Apob UTSW 12 8012759 missense probably benign 0.21
R4678:Apob UTSW 12 7995585 missense probably damaging 1.00
R4685:Apob UTSW 12 8006456 missense probably benign 0.00
R4726:Apob UTSW 12 7990267 missense probably damaging 0.98
R4792:Apob UTSW 12 8008051 missense probably benign 0.26
R4822:Apob UTSW 12 8015741 missense probably benign 0.04
R4834:Apob UTSW 12 8014101 missense possibly damaging 0.49
R4835:Apob UTSW 12 8015391 missense possibly damaging 0.56
R4887:Apob UTSW 12 8013099 missense probably damaging 1.00
R4910:Apob UTSW 12 8007848 missense probably damaging 1.00
R5072:Apob UTSW 12 8008714 missense probably benign 0.00
R5073:Apob UTSW 12 8005219 critical splice donor site probably null
R5074:Apob UTSW 12 8005219 critical splice donor site probably null
R5101:Apob UTSW 12 8011934 missense probably benign 0.09
R5123:Apob UTSW 12 8007630 unclassified probably null
R5133:Apob UTSW 12 8008898 missense probably damaging 0.99
R5135:Apob UTSW 12 8010086 missense probably damaging 1.00
R5137:Apob UTSW 12 8011384 missense possibly damaging 0.63
R5160:Apob UTSW 12 8012126 missense possibly damaging 0.90
R5173:Apob UTSW 12 8008238 missense probably benign 0.00
R5202:Apob UTSW 12 8013737 missense probably damaging 0.98
R5229:Apob UTSW 12 7977806 missense probably benign
R5292:Apob UTSW 12 8005912 missense probably benign 0.01
R5378:Apob UTSW 12 8011865 missense probably damaging 0.99
R5494:Apob UTSW 12 8011762 missense probably damaging 0.99
R5517:Apob UTSW 12 7990906 missense probably damaging 1.00
R5576:Apob UTSW 12 7998662 missense probably damaging 1.00
R5582:Apob UTSW 12 8010788 missense probably damaging 1.00
R5629:Apob UTSW 12 8007847 missense probably damaging 1.00
R5678:Apob UTSW 12 7991494 missense possibly damaging 0.92
R5732:Apob UTSW 12 8010353 missense probably benign 0.15
R5734:Apob UTSW 12 7988781 missense probably damaging 1.00
R5742:Apob UTSW 12 8007191 missense probably damaging 1.00
R5751:Apob UTSW 12 8012619 nonsense probably null
R5776:Apob UTSW 12 8006149 missense possibly damaging 0.57
R5778:Apob UTSW 12 8015074 missense probably benign 0.45
R5783:Apob UTSW 12 8001022 missense probably damaging 1.00
R5786:Apob UTSW 12 8015304 missense possibly damaging 0.48
R5837:Apob UTSW 12 8003277 missense probably benign 0.04
R5857:Apob UTSW 12 8015397 missense probably benign 0.00
R6029:Apob UTSW 12 8016243 missense probably damaging 0.99
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6032:Apob UTSW 12 7995513 missense probably benign 0.02
R6086:Apob UTSW 12 8015164 missense probably benign
R6110:Apob UTSW 12 8011883 missense probably damaging 1.00
R6131:Apob UTSW 12 8015874 missense probably benign 0.17
R6157:Apob UTSW 12 8006077 missense probably benign
R6179:Apob UTSW 12 8005060 nonsense probably null
R6247:Apob UTSW 12 8001801 missense probably damaging 1.00
R6279:Apob UTSW 12 8007769 nonsense probably null
R6300:Apob UTSW 12 8007769 nonsense probably null
R6320:Apob UTSW 12 7989194 missense probably benign 0.27
R6339:Apob UTSW 12 8016188 missense probably damaging 0.99
R6353:Apob UTSW 12 8009421 missense probably damaging 1.00
R6395:Apob UTSW 12 8008507 missense probably benign 0.45
R6441:Apob UTSW 12 7987796 missense probably damaging 1.00
R6492:Apob UTSW 12 8008261 missense probably damaging 0.99
R6495:Apob UTSW 12 7990394 missense probably null 1.00
R6502:Apob UTSW 12 8001814 missense probably damaging 0.99
R6520:Apob UTSW 12 7983124 missense probably damaging 1.00
R6644:Apob UTSW 12 8009077 missense probably damaging 0.97
R6704:Apob UTSW 12 8010379 missense probably damaging 0.98
R6750:Apob UTSW 12 7997853 missense probably damaging 1.00
R6759:Apob UTSW 12 8011049 missense probably benign 0.06
R6812:Apob UTSW 12 7983062 missense probably damaging 0.98
R6865:Apob UTSW 12 8008847 missense probably benign 0.05
R6873:Apob UTSW 12 8015995 missense probably benign 0.00
R7013:Apob UTSW 12 8010080 nonsense probably null
R7067:Apob UTSW 12 8009423 missense probably damaging 1.00
R7084:Apob UTSW 12 8009591 missense probably benign
R7113:Apob UTSW 12 7995539 missense probably damaging 1.00
R7175:Apob UTSW 12 8007034 missense probably benign 0.33
R7196:Apob UTSW 12 7983893 missense possibly damaging 0.90
R7199:Apob UTSW 12 8005072 missense probably damaging 1.00
R7205:Apob UTSW 12 8005087 missense probably damaging 0.98
R7251:Apob UTSW 12 8007037 missense probably damaging 0.98
X0027:Apob UTSW 12 8007975 missense probably benign
Z1088:Apob UTSW 12 8005074 missense possibly damaging 0.91
Z1088:Apob UTSW 12 8005945 nonsense probably null
Z1088:Apob UTSW 12 8012936 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCAAATATGGCCTGTCTTGTG -3'
(R):5'- GTCTGTGCCCAAGATGTCAG -3'

Sequencing Primer
(F):5'- CTGTCTTGTGAGAGAGATGTTACAAC -3'
(R):5'- TTCTACACCCTGGGAAGTGAG -3'
Posted On2015-10-21