Incidental Mutation 'R0211:Dyx1c1'
ID35538
Institutional Source Beutler Lab
Gene Symbol Dyx1c1
Ensembl Gene ENSMUSG00000092192
Gene Namedyslexia susceptibility 1 candidate 1
Synonyms1700010I24Rik, b2b811Clo, EKN1
MMRRC Submission 038462-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R0211 (G1)
Quality Score181
Status Not validated
Chromosome9
Chromosomal Location72958785-72973064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72961367 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 127 (R127S)
Ref Sequence ENSEMBL: ENSMUSP00000034734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034734] [ENSMUST00000098567] [ENSMUST00000149692]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034734
AA Change: R127S

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034734
Gene: ENSMUSG00000092192
AA Change: R127S

DomainStartEndE-ValueType
Pfam:CS 6 77 5.8e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
TPR 288 321 2.56e1 SMART
TPR 322 355 1.26e-1 SMART
TPR 364 397 2.59e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098567
SMART Domains Protein: ENSMUSP00000096166
Gene: ENSMUSG00000092192

DomainStartEndE-ValueType
Pfam:CS 6 77 1.3e-14 PFAM
TPR 168 201 2.56e1 SMART
TPR 202 235 1.26e-1 SMART
TPR 244 277 2.59e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149692
AA Change: R127S

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865
AA Change: R127S

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit both pre- and postnatal lethality, hydrocephalus, and defects in organ laterality and ciliary motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,216,096 L1401P possibly damaging Het
4930503B20Rik C T 3: 146,650,496 R219H probably benign Het
Abcc9 T A 6: 142,688,984 I185F probably benign Het
Adgrf1 T C 17: 43,296,690 L100P probably damaging Het
Akt1 T C 12: 112,655,142 T407A probably damaging Het
Alk C T 17: 72,603,516 R65H probably damaging Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Arhgef12 G A 9: 42,972,004 R1411C probably damaging Het
Arnt T A 3: 95,476,149 M242K probably damaging Het
Atad5 T G 11: 80,095,647 V520G probably benign Het
Avpr1a T A 10: 122,449,469 M222K possibly damaging Het
Cbr2 T A 11: 120,730,788 I88L probably benign Het
Cc2d2a T A 5: 43,688,266 probably null Het
Ccdc51 T C 9: 109,089,373 M10T probably benign Het
Cntnap5b T A 1: 100,478,374 D1136E possibly damaging Het
Coil T A 11: 88,982,153 S447T probably damaging Het
Cryba1 T A 11: 77,718,867 Y179F probably damaging Het
Dcaf4 T A 12: 83,535,961 F277I probably damaging Het
Ddost G A 4: 138,309,602 V159M probably damaging Het
Dnajb6 T C 5: 29,785,079 probably benign Het
Dnase2a A G 8: 84,908,788 probably benign Het
Dscam T C 16: 96,716,079 I877V possibly damaging Het
Efcc1 A T 6: 87,749,154 T312S probably benign Het
Ermard A T 17: 15,021,943 Q127L probably damaging Het
F2 T C 2: 91,630,158 E329G probably damaging Het
Foxc2 T A 8: 121,116,616 M1K probably null Het
Fuz T A 7: 44,899,022 probably null Het
Ggnbp2 G A 11: 84,840,313 T325M probably damaging Het
Gm6408 T A 5: 146,483,060 F115I probably benign Het
Gm8909 T C 17: 36,168,007 T117A probably damaging Het
Gp6 C T 7: 4,373,209 probably null Het
Grin2a A G 16: 9,579,173 S1017P possibly damaging Het
Hmmr A T 11: 40,714,808 M318K probably damaging Het
Ifi205 T C 1: 174,028,428 E12G probably benign Het
Ift74 C T 4: 94,679,255 T395I probably benign Het
Ikbkap T A 4: 56,795,545 I143F probably damaging Het
Irf8 A T 8: 120,739,975 D53V probably damaging Het
Itgad A G 7: 128,204,641 Y69C probably damaging Het
Itpr2 C A 6: 146,194,613 R2084L probably benign Het
Krt4 C A 15: 101,922,782 S228I possibly damaging Het
Lpin3 A T 2: 160,898,681 D382V probably damaging Het
Ltbp3 T C 19: 5,752,143 probably null Het
Map4k3 C T 17: 80,644,841 A179T probably damaging Het
Nck1 A T 9: 100,497,767 W144R probably damaging Het
Ndufb9 A T 15: 58,939,282 Q139L possibly damaging Het
Ngfr T G 11: 95,571,912 E300A probably damaging Het
Nin T G 12: 70,014,875 T2072P probably damaging Het
Nop2 T G 6: 125,141,344 L529R probably damaging Het
Nrm T A 17: 35,864,611 L203Q probably damaging Het
Nynrin T C 14: 55,871,798 F1454S probably benign Het
Olfr1062 A C 2: 86,423,107 S190A probably damaging Het
Olfr1328 T A 4: 118,934,270 M191L probably benign Het
Olfr1453 T C 19: 13,028,282 T16A possibly damaging Het
Os9 A G 10: 127,121,036 V27A probably damaging Het
Osbpl9 T G 4: 109,073,124 T332P probably damaging Het
Pcdhb10 A T 18: 37,414,006 M712L probably benign Het
Pcx C T 19: 4,620,199 A935V probably damaging Het
Pdzd7 A G 19: 45,033,667 V514A possibly damaging Het
Plin4 C T 17: 56,102,242 G1326D probably damaging Het
Plxnb1 T A 9: 109,103,663 Y568* probably null Het
Pmfbp1 T A 8: 109,541,740 V973D probably benign Het
Ppp2r1b T C 9: 50,861,625 V70A probably benign Het
Prkar2b C A 12: 31,972,184 V201L probably benign Het
Rgr T G 14: 37,046,968 T37P probably damaging Het
Ripk3 A T 14: 55,787,918 L63Q probably damaging Het
Rpusd2 A G 2: 119,038,412 S439G probably benign Het
Serac1 T A 17: 6,050,060 R438S possibly damaging Het
Slc19a1 T A 10: 77,038,466 S24T possibly damaging Het
Slc6a21 A C 7: 45,288,243 T653P possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spdef C T 17: 27,714,920 R309H probably damaging Het
Srp68 A T 11: 116,265,551 Y84N probably damaging Het
Syne2 A T 12: 76,097,957 Q6299L probably damaging Het
Tmem63b T A 17: 45,661,913 M652L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnk1 A G 11: 69,855,181 V306A probably damaging Het
Tnnc2 T A 2: 164,777,484 I147F probably damaging Het
Tnni3k C T 3: 155,055,344 probably benign Het
Togaram2 T A 17: 71,729,248 V911D probably damaging Het
Tyw3 T C 3: 154,587,495 N181S probably damaging Het
Unc79 T A 12: 103,072,792 S682T probably benign Het
Vps13d A G 4: 145,114,778 L2634S probably benign Het
Wasl G T 6: 24,633,893 A124E probably damaging Het
Zfp287 T C 11: 62,714,917 H388R probably damaging Het
Zfp335 T C 2: 164,907,692 T262A probably damaging Het
Zfp457 C G 13: 67,293,147 G359R probably benign Het
Zfp536 T A 7: 37,568,449 E514V probably damaging Het
Zfp872 T A 9: 22,200,173 I316N probably damaging Het
Other mutations in Dyx1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dyx1c1 APN 9 72969066 missense probably benign 0.02
R0310:Dyx1c1 UTSW 9 72972336 missense probably damaging 1.00
R0712:Dyx1c1 UTSW 9 72960657 nonsense probably null
R1791:Dyx1c1 UTSW 9 72960684 missense possibly damaging 0.90
R1927:Dyx1c1 UTSW 9 72960627 missense probably damaging 0.98
R3085:Dyx1c1 UTSW 9 72972406 missense probably benign 0.00
R4624:Dyx1c1 UTSW 9 72964171 missense probably benign 0.01
R4998:Dyx1c1 UTSW 9 72960678 missense possibly damaging 0.93
R5008:Dyx1c1 UTSW 9 72972318 intron probably benign
R5200:Dyx1c1 UTSW 9 72972431 missense probably damaging 1.00
R5256:Dyx1c1 UTSW 9 72972080 critical splice donor site probably null
R5806:Dyx1c1 UTSW 9 72962054 missense probably benign 0.06
R5930:Dyx1c1 UTSW 9 72971998 missense probably damaging 1.00
R6751:Dyx1c1 UTSW 9 72961975 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTTGAGCTGGGTGCCATTCAC -3'
(R):5'- TGATGGCTGCGACTTCTGATCCTC -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- CCTGTTTCACCCTCCTGAG -3'
Posted On2013-05-09