Incidental Mutation 'R4708:Olfr551'
ID355414
Institutional Source Beutler Lab
Gene Symbol Olfr551
Ensembl Gene ENSMUSG00000073974
Gene Nameolfactory receptor 551
SynonymsMOR29-1, GA_x6K02T2PBJ9-5307445-5306498
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102583510-102591886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102587836 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 302 (D302E)
Ref Sequence ENSEMBL: ENSMUSP00000150582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098224] [ENSMUST00000213540] [ENSMUST00000216524]
Predicted Effect probably benign
Transcript: ENSMUST00000098224
AA Change: D302E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095827
Gene: ENSMUSG00000073974
AA Change: D302E

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.8e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 152 2e-9 PFAM
Pfam:7tm_1 43 293 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213540
AA Change: D302E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216524
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Olfr551
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Olfr551 APN 7 102588229 nonsense probably null
IGL03034:Olfr551 APN 7 102587940 missense probably benign 0.42
IGL03076:Olfr551 APN 7 102588472 missense probably benign
R0564:Olfr551 UTSW 7 102588531 missense probably benign
R0890:Olfr551 UTSW 7 102588201 nonsense probably null
R0909:Olfr551 UTSW 7 102588447 missense probably damaging 1.00
R1053:Olfr551 UTSW 7 102587959 nonsense probably null
R4932:Olfr551 UTSW 7 102588416 missense probably damaging 0.98
R6248:Olfr551 UTSW 7 102588030 missense probably benign 0.00
R6343:Olfr551 UTSW 7 102588546 missense probably damaging 0.98
R6389:Olfr551 UTSW 7 102588472 missense probably benign
R6455:Olfr551 UTSW 7 102588671 missense probably benign 0.00
R7305:Olfr551 UTSW 7 102587955 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGATACCTCCTCTGACAAGTGATAG -3'
(R):5'- ACCTTTGGCACTTGTGGCTC -3'

Sequencing Primer
(F):5'- TCCTCTGACAAGTGATAGAACTC -3'
(R):5'- GGCTCCCACCTAGGTGTCATC -3'
Posted On2015-10-21