Incidental Mutation 'R4708:Bag4'
ID355419
Institutional Source Beutler Lab
Gene Symbol Bag4
Ensembl Gene ENSMUSG00000037316
Gene NameBCL2-associated athanogene 4
Synonyms
MMRRC Submission 042017-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R4708 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25764538-25785287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25769488 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 228 (A228T)
Ref Sequence ENSEMBL: ENSMUSP00000044725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038498]
Predicted Effect probably benign
Transcript: ENSMUST00000038498
AA Change: A228T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044725
Gene: ENSMUSG00000037316
AA Change: A228T

DomainStartEndE-ValueType
low complexity region 5 49 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 276 301 N/A INTRINSIC
BAG 379 456 3.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210103
Meta Mutation Damage Score 0.0436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant animals may show enhanced cytokine response and increased IL-6 production following TNF challenge. Studies on two different alleles of this gene are not in agreement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,611,885 G2D probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4930505A04Rik T C 11: 30,454,717 Y62C probably damaging Het
4931408C20Rik A T 1: 26,684,440 V553D possibly damaging Het
Aadacl4 A C 4: 144,623,329 K385N probably benign Het
Abcb4 A T 5: 8,915,125 T332S possibly damaging Het
Aco2 G A 15: 81,909,916 probably null Het
Aplf G T 6: 87,663,757 S69Y probably damaging Het
Arhgap27 A G 11: 103,333,562 probably benign Het
B4galnt1 T A 10: 127,169,815 Y262N probably damaging Het
BC017158 A G 7: 128,274,680 V345A probably benign Het
Ccdc62 T G 5: 123,930,862 probably null Het
Cd109 T A 9: 78,672,589 I649K probably benign Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cep290 A G 10: 100,523,264 K952R probably benign Het
Ces2a A G 8: 104,737,306 H190R probably benign Het
Clec14a A G 12: 58,267,703 S378P probably benign Het
Col27a1 A G 4: 63,283,913 Q947R probably benign Het
Dennd3 A G 15: 73,523,495 T146A probably damaging Het
Dpy19l4 T A 4: 11,277,970 M486L probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eif4enif1 T G 11: 3,220,323 H125Q probably damaging Het
Fam35a A G 14: 34,267,833 V372A probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Fubp3 C T 2: 31,608,110 T92I probably benign Het
Gm19426 T C 2: 84,743,459 probably null Het
Gtf2ird2 A G 5: 134,216,298 H466R probably damaging Het
Hdac5 T C 11: 102,202,193 S573G probably damaging Het
Iars2 A T 1: 185,289,357 M916K probably benign Het
Insr A T 8: 3,211,346 probably benign Het
Itgam T C 7: 128,101,537 V493A probably damaging Het
Ivl T A 3: 92,571,750 K336I probably damaging Het
Kcng2 A G 18: 80,322,852 I95T probably damaging Het
Lap3 A G 5: 45,511,138 R431G probably damaging Het
Lrrc66 T C 5: 73,629,662 H115R probably benign Het
Morc3 T C 16: 93,873,238 V767A probably benign Het
Mttp A G 3: 138,134,098 probably benign Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Nat9 G A 11: 115,183,443 T133M probably damaging Het
Nectin4 T C 1: 171,385,146 I349T probably benign Het
Nlrp4a A G 7: 26,464,108 E900G probably benign Het
Nlrp9c A T 7: 26,384,840 M438K probably benign Het
Olfr1384 T A 11: 49,514,389 Y250* probably null Het
Olfr1444 A T 19: 12,861,897 I41F probably benign Het
Olfr551 A T 7: 102,587,836 D302E probably benign Het
Parp6 T C 9: 59,641,769 I507T probably damaging Het
Pde6c G A 19: 38,180,893 E804K possibly damaging Het
Plscr2 A G 9: 92,291,014 Y203C probably damaging Het
Ptprs A G 17: 56,428,067 W216R probably damaging Het
Rhof T A 5: 123,120,391 T126S probably benign Het
Riox2 A G 16: 59,475,682 I49V probably benign Het
Tmc6 A T 11: 117,768,948 C750S probably benign Het
Tmem231 C A 8: 111,933,786 probably benign Het
Tmem94 T A 11: 115,786,295 I131N possibly damaging Het
Tmx3 T C 18: 90,521,039 probably null Het
Tnfrsf21 C T 17: 43,038,232 T245I possibly damaging Het
Ttbk2 C A 2: 120,739,861 R1201S probably damaging Het
Vmn2r102 A T 17: 19,694,314 M714L probably benign Het
Vmn2r109 A G 17: 20,541,343 L584S probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Vnn1 T A 10: 23,897,352 D92E probably benign Het
Zan T C 5: 137,446,712 I1762V unknown Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfhx4 A G 3: 5,245,503 probably null Het
Zfp560 T C 9: 20,351,918 E54G possibly damaging Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Zmynd11 A C 13: 9,695,753 V188G probably damaging Het
Other mutations in Bag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Bag4 APN 8 25771225 missense probably benign
IGL02074:Bag4 APN 8 25769355 missense possibly damaging 0.87
IGL02129:Bag4 APN 8 25768085 missense probably damaging 1.00
IGL02183:Bag4 APN 8 25768030 missense probably damaging 1.00
IGL02441:Bag4 APN 8 25768108 missense probably damaging 1.00
R0414:Bag4 UTSW 8 25767997 missense possibly damaging 0.91
R1103:Bag4 UTSW 8 25767863 utr 3 prime probably benign
R1423:Bag4 UTSW 8 25768274 missense probably damaging 0.99
R1650:Bag4 UTSW 8 25777424 missense probably damaging 0.99
R2045:Bag4 UTSW 8 25769488 missense probably benign
R2333:Bag4 UTSW 8 25769488 missense probably benign
R2945:Bag4 UTSW 8 25771252 missense probably benign 0.08
R3124:Bag4 UTSW 8 25769488 missense probably benign
R3125:Bag4 UTSW 8 25769488 missense probably benign
R4428:Bag4 UTSW 8 25769488 missense probably benign
R4429:Bag4 UTSW 8 25769488 missense probably benign
R4431:Bag4 UTSW 8 25769488 missense probably benign
R4467:Bag4 UTSW 8 25769488 missense probably benign
R4482:Bag4 UTSW 8 25785044 unclassified probably benign
R4538:Bag4 UTSW 8 25769488 missense probably benign
R4539:Bag4 UTSW 8 25769488 missense probably benign
R4541:Bag4 UTSW 8 25769488 missense probably benign
R4542:Bag4 UTSW 8 25769488 missense probably benign
R4663:Bag4 UTSW 8 25769488 missense probably benign
R4710:Bag4 UTSW 8 25769488 missense probably benign
R4732:Bag4 UTSW 8 25769488 missense probably benign
R4733:Bag4 UTSW 8 25769488 missense probably benign
R4970:Bag4 UTSW 8 25771244 nonsense probably null
R5175:Bag4 UTSW 8 25768351 missense probably damaging 0.99
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6084:Bag4 UTSW 8 25771231 missense probably benign 0.00
R6595:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R6596:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R7564:Bag4 UTSW 8 25777479 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTACCTTAGGCTGCTGAG -3'
(R):5'- TGGGAGCCAGGTTTTCTCAG -3'

Sequencing Primer
(F):5'- CCTTAGGCTGCTGAGGTGGG -3'
(R):5'- CTCAGGTGTGGAGAACTTTTGGTAAC -3'
Posted On2015-10-21