Incidental Mutation 'R4694:Prelp'
ID355527
Institutional Source Beutler Lab
Gene Symbol Prelp
Ensembl Gene ENSMUSG00000041577
Gene Nameproline arginine-rich end leucine-rich repeat
Synonyms7330409J17Rik, SLRR2A
MMRRC Submission 041945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4694 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133910304-133921414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133914747 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 220 (M220T)
Ref Sequence ENSEMBL: ENSMUSP00000048803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048432]
Predicted Effect probably damaging
Transcript: ENSMUST00000048432
AA Change: M220T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048803
Gene: ENSMUSG00000041577
AA Change: M220T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 63 N/A INTRINSIC
LRRNT 68 102 5.86e-11 SMART
LRR 98 120 3.27e1 SMART
LRR 122 144 1.37e2 SMART
LRR 145 168 2.14e0 SMART
LRR 169 189 4.97e0 SMART
LRR 190 215 2.47e1 SMART
LRR 216 239 9.75e0 SMART
LRR 241 260 2.15e2 SMART
LRR 286 309 1.53e1 SMART
Blast:LRR 345 369 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160564
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a leucine-rich repeat protein present in connective tissue extracellular matrix. This protein functions as a molecule anchoring basement membranes to the underlying connective tissue. This protein has been shown to bind type I collagen to basement membranes and type II collagen to cartilage. It also binds the basement membrane heparan sulfate proteoglycan perlecan. This protein is suggested to be involved in the pathogenesis of Hutchinson-Gilford progeria (HGP), which is reported to lack the binding of collagen in basement membranes and cartilage. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Prelp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prelp APN 1 133914807 missense probably benign 0.03
IGL02869:Prelp APN 1 133915267 nonsense probably null
R0972:Prelp UTSW 1 133914676 missense probably damaging 0.99
R1728:Prelp UTSW 1 133915131 missense probably benign
R1729:Prelp UTSW 1 133915131 missense probably benign
R1730:Prelp UTSW 1 133915131 missense probably benign
R1739:Prelp UTSW 1 133915131 missense probably benign
R1762:Prelp UTSW 1 133915131 missense probably benign
R1783:Prelp UTSW 1 133915131 missense probably benign
R1784:Prelp UTSW 1 133915131 missense probably benign
R1785:Prelp UTSW 1 133915131 missense probably benign
R1843:Prelp UTSW 1 133914757 missense probably damaging 0.99
R2049:Prelp UTSW 1 133915131 missense probably benign
R2130:Prelp UTSW 1 133915131 missense probably benign
R2131:Prelp UTSW 1 133915131 missense probably benign
R2133:Prelp UTSW 1 133915131 missense probably benign
R2141:Prelp UTSW 1 133915131 missense probably benign
R2142:Prelp UTSW 1 133915131 missense probably benign
R6398:Prelp UTSW 1 133914741 missense probably damaging 1.00
R6415:Prelp UTSW 1 133912778 missense probably benign 0.38
R6415:Prelp UTSW 1 133914657 missense probably damaging 1.00
R6678:Prelp UTSW 1 133914775 missense probably benign 0.00
R6767:Prelp UTSW 1 133912710 missense probably benign 0.02
X0066:Prelp UTSW 1 133915276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACCAGCAAGTTGGAGATG -3'
(R):5'- CTACATGGAGAAGAACCAGCTG -3'

Sequencing Primer
(F):5'- AAGGAGTTCTTGGGGAGCCC -3'
(R):5'- CAGCTGGAAGAGGTGCCATC -3'
Posted On2015-10-21