Incidental Mutation 'R4694:Prss36'
ID355557
Institutional Source Beutler Lab
Gene Symbol Prss36
Ensembl Gene ENSMUSG00000070371
Gene Nameprotease, serine 36
Synonymspolyserase-2, C330007D15Rik
MMRRC Submission 041945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R4694 (G1)
Quality Score136
Status Not validated
Chromosome7
Chromosomal Location127932638-127946725 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127935615 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 465 (W465R)
Ref Sequence ENSEMBL: ENSMUSP00000112659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094026] [ENSMUST00000118755] [ENSMUST00000141385] [ENSMUST00000156152]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094026
AA Change: W476R

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091565
Gene: ENSMUSG00000070371
AA Change: W476R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 556 1.2e-16 PFAM
Pfam:Trypsin 599 798 6.6e-20 PFAM
Pfam:DUF1986 607 707 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118755
AA Change: W465R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112659
Gene: ENSMUSG00000070371
AA Change: W465R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 545 9.7e-18 PFAM
Pfam:Trypsin 588 787 6.5e-20 PFAM
Pfam:DUF1986 590 696 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141385
SMART Domains Protein: ENSMUSP00000120544
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Blast:Tryp_SPc 38 121 3e-44 BLAST
SCOP:d1eaxa_ 45 126 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150591
SMART Domains Protein: ENSMUSP00000121532
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Tryp_SPc 15 194 6.48e-2 SMART
Blast:Tryp_SPc 231 311 4e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153110
Predicted Effect probably benign
Transcript: ENSMUST00000156152
SMART Domains Protein: ENSMUSP00000121706
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Blast:Tryp_SPc 2 44 1e-21 BLAST
Tryp_SPc 89 238 8.18e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Prss36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Prss36 APN 7 127944927 splice site probably benign
IGL01473:Prss36 APN 7 127944701 missense probably damaging 0.98
IGL03139:Prss36 APN 7 127933611 missense probably damaging 1.00
R0111:Prss36 UTSW 7 127934545 missense probably damaging 1.00
R0295:Prss36 UTSW 7 127935855 missense possibly damaging 0.80
R1771:Prss36 UTSW 7 127933453 missense probably damaging 1.00
R1827:Prss36 UTSW 7 127933492 missense probably damaging 1.00
R3935:Prss36 UTSW 7 127934608 missense probably damaging 1.00
R4257:Prss36 UTSW 7 127932838 unclassified probably benign
R5384:Prss36 UTSW 7 127936699 missense probably damaging 1.00
R5464:Prss36 UTSW 7 127934233 missense probably damaging 1.00
R5524:Prss36 UTSW 7 127934465 nonsense probably null
R5749:Prss36 UTSW 7 127933642 missense probably damaging 1.00
R5905:Prss36 UTSW 7 127933572 missense probably benign 0.26
R5992:Prss36 UTSW 7 127944830 missense probably damaging 1.00
R6033:Prss36 UTSW 7 127934567 missense probably benign 0.07
R6033:Prss36 UTSW 7 127934567 missense probably benign 0.07
R6971:Prss36 UTSW 7 127945238 missense probably benign 0.15
Z1088:Prss36 UTSW 7 127934537 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTTTGGCACCATGCGGAG -3'
(R):5'- ACACTATTTTCTGCCCGGG -3'

Sequencing Primer
(F):5'- ACCATGCGGAGGCCAGAAC -3'
(R):5'- TATTTTCTGCCCGGGAGCCAC -3'
Posted On2015-10-21