Incidental Mutation 'R4694:Trank1'
ID355572
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 041945-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4694 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111392061 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 2622 (Q2622L)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably benign
Transcript: ENSMUST00000078626
AA Change: Q2622L

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: Q2622L

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198890
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Zfp946 G A 17: 22,455,711 G482E probably benign Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2050:Trank1 UTSW 9 111364788 missense probably damaging 1.00
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATGTGACCAGAGCTATCC -3'
(R):5'- TTGGTATGCACACTGTCCCAC -3'

Sequencing Primer
(F):5'- ACCAGAGCTATCCGGGACTTC -3'
(R):5'- ACTGTCCCACCGCCAGTG -3'
Posted On2015-10-21