Incidental Mutation 'R4694:Zfp946'
ID355587
Institutional Source Beutler Lab
Gene Symbol Zfp946
Ensembl Gene ENSMUSG00000071266
Gene Namezinc finger protein 946
Synonyms
MMRRC Submission 041945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4694 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location22424222-22456689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22455711 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 482 (G482E)
Ref Sequence ENSEMBL: ENSMUSP00000132940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088763] [ENSMUST00000120222] [ENSMUST00000167740]
Predicted Effect probably benign
Transcript: ENSMUST00000088763
AA Change: G482E

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000086141
Gene: ENSMUSG00000071266
AA Change: G482E

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120222
AA Change: G482E

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113244
Gene: ENSMUSG00000071266
AA Change: G482E

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167740
AA Change: G482E

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132940
Gene: ENSMUSG00000071266
AA Change: G482E

DomainStartEndE-ValueType
KRAB 13 71 4.49e-17 SMART
ZnF_C2H2 186 208 3.83e-2 SMART
ZnF_C2H2 242 264 1.6e-4 SMART
ZnF_C2H2 270 292 1.45e-2 SMART
ZnF_C2H2 298 320 5.99e-4 SMART
ZnF_C2H2 326 348 2.15e-5 SMART
ZnF_C2H2 354 376 2.4e-3 SMART
ZnF_C2H2 382 404 1.28e-3 SMART
ZnF_C2H2 410 432 2.09e-3 SMART
ZnF_C2H2 438 460 9.44e-2 SMART
ZnF_C2H2 466 488 3.44e-4 SMART
ZnF_C2H2 494 516 1.5e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,672,158 F258Y probably damaging Het
Adamtsl4 C T 3: 95,679,745 R765H probably damaging Het
Bicd1 T A 6: 149,409,553 L42Q probably damaging Het
Cacna1e C T 1: 154,437,266 probably null Het
Capn1 T A 19: 5,994,731 K504* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep350 T C 1: 155,928,586 K917R probably damaging Het
Cp A T 3: 19,974,885 T509S probably benign Het
Cyp2d10 T C 15: 82,404,483 D266G probably damaging Het
Dhodh C G 8: 109,606,416 R7P probably damaging Het
Dmxl2 A G 9: 54,446,905 L419P probably benign Het
Epb41l4b A T 4: 57,019,875 M84K probably benign Het
Fbln7 A G 2: 128,880,425 probably null Het
Fbxw11 C T 11: 32,642,820 probably benign Het
Flnc C A 6: 29,443,448 P543T probably damaging Het
Gm13103 T C 4: 143,852,960 S372P probably damaging Het
Grid1 T C 14: 35,026,780 S186P probably damaging Het
Hcfc2 C T 10: 82,723,700 T382M probably damaging Het
Hdac9 G T 12: 34,437,247 L73I probably damaging Het
Hnrnpa2b1 A T 6: 51,464,183 D302E probably damaging Het
Ifi204 C T 1: 173,749,259 C592Y probably damaging Het
Jph1 T A 1: 16,997,505 I653F probably damaging Het
Kcnj3 A G 2: 55,594,906 K339E probably benign Het
Kcp G A 6: 29,493,197 T838I probably benign Het
Krtap26-1 A T 16: 88,647,220 V171E possibly damaging Het
Lck G T 4: 129,548,972 N452K possibly damaging Het
Madd A G 2: 91,160,328 L1134S probably damaging Het
Mafk T C 5: 139,800,493 S149P probably damaging Het
Man1c1 T C 4: 134,703,189 D94G probably benign Het
Me2 T A 18: 73,801,859 M38L probably benign Het
Muc2 A C 7: 141,752,345 D257A probably damaging Het
Myh11 T C 16: 14,200,702 K1927E probably damaging Het
Naaladl1 C T 19: 6,108,890 P324S probably damaging Het
Ndufa10 T C 1: 92,452,102 E303G probably benign Het
Nedd1 C T 10: 92,719,582 V14I probably benign Het
Nwd1 T G 8: 72,667,330 V407G probably damaging Het
Olfr1136 T A 2: 87,693,760 T41S probably benign Het
Olfr132 A C 17: 38,130,857 C112G probably damaging Het
Olfr32 T A 2: 90,138,249 K297* probably null Het
Olfr726 T C 14: 50,084,019 I221V probably benign Het
Olfr847 A G 9: 19,375,398 L161P probably damaging Het
Pgrmc2 T C 3: 41,070,405 D144G probably damaging Het
Ppp3cb T C 14: 20,501,515 N516S probably benign Het
Prelp A G 1: 133,914,747 M220T probably damaging Het
Prss36 A G 7: 127,935,615 W465R probably damaging Het
Pth2r C A 1: 65,336,761 F59L probably benign Het
Rab20 C T 8: 11,454,485 G72R probably damaging Het
Rab4a G T 8: 123,829,030 G49W probably damaging Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rhox2c A C X: 37,453,698 Q4H probably benign Het
Rock1 A T 18: 10,136,152 Y178* probably null Het
Scaf8 C A 17: 3,197,404 L1001I probably damaging Het
Sema3b G A 9: 107,605,002 P26S probably benign Het
Slc23a1 A G 18: 35,619,580 L548P probably damaging Het
Sncaip A C 18: 52,906,557 T548P probably benign Het
Stpg2 C T 3: 139,317,416 P398S possibly damaging Het
Stpg3 A C 2: 25,213,297 V260G probably damaging Het
Tbc1d9 T A 8: 83,234,246 F242I probably damaging Het
Tnks1bp1 G A 2: 85,071,722 R992Q probably damaging Het
Tom1l1 T G 11: 90,646,849 H394P possibly damaging Het
Topors T G 4: 40,261,442 N614T possibly damaging Het
Trank1 A T 9: 111,392,061 Q2622L probably benign Het
Trub2 A G 2: 29,778,846 S186P probably damaging Het
Unc13c T A 9: 73,572,354 H1756L probably benign Het
Vmn1r9 A T 6: 57,071,329 I130F probably benign Het
Wdr72 A T 9: 74,179,555 I602F probably damaging Het
Zfand3 T A 17: 30,135,388 F60I possibly damaging Het
Other mutations in Zfp946
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Zfp946 APN 17 22454662 missense possibly damaging 0.88
IGL01869:Zfp946 APN 17 22454703 missense probably benign 0.45
IGL02037:Zfp946 APN 17 22453488 missense probably damaging 1.00
IGL03111:Zfp946 APN 17 22454556 missense possibly damaging 0.76
R0324:Zfp946 UTSW 17 22454436 missense probably benign 0.41
R1252:Zfp946 UTSW 17 22453579 critical splice donor site probably null
R1733:Zfp946 UTSW 17 22453557 missense probably damaging 1.00
R1971:Zfp946 UTSW 17 22455425 missense probably damaging 1.00
R2064:Zfp946 UTSW 17 22455465 missense probably damaging 1.00
R2106:Zfp946 UTSW 17 22453485 missense probably benign 0.30
R2216:Zfp946 UTSW 17 22454716 missense possibly damaging 0.49
R3899:Zfp946 UTSW 17 22454550 missense probably benign 0.05
R3924:Zfp946 UTSW 17 22455701 missense probably benign 0.06
R4125:Zfp946 UTSW 17 22454567 nonsense probably null
R4493:Zfp946 UTSW 17 22451086 splice site probably null
R4924:Zfp946 UTSW 17 22455521 missense probably damaging 1.00
R4939:Zfp946 UTSW 17 22455437 missense probably damaging 1.00
R5020:Zfp946 UTSW 17 22455603 missense probably benign 0.03
R5248:Zfp946 UTSW 17 22454466 missense probably benign 0.12
R5547:Zfp946 UTSW 17 22454892 missense probably benign 0.00
R5551:Zfp946 UTSW 17 22455384 missense probably damaging 1.00
R5573:Zfp946 UTSW 17 22454695 nonsense probably null
R6048:Zfp946 UTSW 17 22454840 missense probably benign 0.03
R6080:Zfp946 UTSW 17 22455109 missense probably benign 0.00
R6198:Zfp946 UTSW 17 22454915 missense probably damaging 1.00
R6332:Zfp946 UTSW 17 22454538 missense probably damaging 1.00
R6766:Zfp946 UTSW 17 22455771 missense probably benign 0.01
R7132:Zfp946 UTSW 17 22454663 missense probably benign 0.41
X0065:Zfp946 UTSW 17 22455513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCTCAAAAGTGGTCTTAGAATTC -3'
(R):5'- TCGGGAAAAGGCCTTCTCTC -3'

Sequencing Primer
(F):5'- TTCATGAGAGAATTCACACAGGAG -3'
(R):5'- GGGAAAAGGCCTTCTCTCACATTTG -3'
Posted On2015-10-21