Incidental Mutation 'R4695:Itln1'
ID355601
Institutional Source Beutler Lab
Gene Symbol Itln1
Ensembl Gene ENSMUSG00000038209
Gene Nameintelectin 1 (galactofuranose binding)
SynonymsmLfR, IntL, Itln2, Itlna
MMRRC Submission 042016-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4695 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171518122-171535294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 171531077 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 174 (G174V)
Ref Sequence ENSEMBL: ENSMUSP00000043837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043094] [ENSMUST00000168184]
Predicted Effect probably damaging
Transcript: ENSMUST00000043094
AA Change: G174V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043837
Gene: ENSMUSG00000038209
AA Change: G174V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FBG 36 211 3.77e0 SMART
Blast:FBG 230 312 8e-47 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000168184
SMART Domains Protein: ENSMUSP00000126385
Gene: ENSMUSG00000038209

DomainStartEndE-ValueType
Blast:FBG 1 108 2e-60 BLAST
SCOP:d1jc9a_ 7 68 5e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a targeted null allele indicates this mutation has no notable phenotype in any parameter tested. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,531,739 M251K possibly damaging Het
Adcy2 A T 13: 68,727,843 H513Q possibly damaging Het
Ahctf1 A G 1: 179,753,054 L1861P possibly damaging Het
Apc2 C A 10: 80,311,043 R615S probably damaging Het
Arhgap45 A C 10: 80,025,530 D509A probably damaging Het
Atp6v1c2 T C 12: 17,301,207 T108A probably benign Het
Blm T A 7: 80,494,228 D821V probably damaging Het
C3 T A 17: 57,221,057 I721L probably benign Het
Ccdc13 A T 9: 121,820,760 V207E probably damaging Het
Ccndbp1 C T 2: 121,014,727 probably benign Het
Cd180 A C 13: 102,705,760 Q438P probably benign Het
Cd248 C T 19: 5,068,445 T107M probably damaging Het
Cdan1 G A 2: 120,728,383 R445C probably damaging Het
Cic C A 7: 25,273,588 H915N possibly damaging Het
Cox8c T C 12: 102,899,483 S40P possibly damaging Het
Cyp2d34 A T 15: 82,616,891 C347S probably benign Het
Dhx30 A T 9: 110,085,288 F974I probably damaging Het
Dlec1 A T 9: 119,143,153 T1414S probably benign Het
Dlg2 C A 7: 92,437,962 probably null Het
Dzip1l T A 9: 99,647,205 M329K probably benign Het
Dzip3 A T 16: 48,951,561 L582I probably damaging Het
Emilin2 T C 17: 71,252,778 Y1068C probably damaging Het
Fam221b T A 4: 43,659,622 probably null Het
Fbxw22 A G 9: 109,378,871 I444T probably damaging Het
Flnc T A 6: 29,440,429 N245K probably damaging Het
Fnip1 T A 11: 54,499,419 I380N probably damaging Het
Gbf1 C T 19: 46,259,167 R181* probably null Het
Igkv6-17 T A 6: 70,371,502 F12I probably benign Het
Lrrc52 A G 1: 167,466,091 probably null Het
Matn2 A G 15: 34,402,925 Y432C probably damaging Het
Metap1d A G 2: 71,524,961 *336W probably null Het
Mgam2-ps T A 6: 40,802,555 noncoding transcript Het
Mrps9 T A 1: 42,862,515 V61D possibly damaging Het
Myh7b T C 2: 155,614,177 Y161H probably damaging Het
Myh9 T A 15: 77,768,853 D1428V probably damaging Het
N4bp3 A T 11: 51,644,479 probably null Het
Nat9 T A 11: 115,184,590 Q75L probably benign Het
Nop2 T C 6: 125,144,556 V767A probably benign Het
Ntrk2 A G 13: 59,126,493 K728E probably damaging Het
Olfr497 G A 7: 108,422,989 M139I probably benign Het
Olfr558 T G 7: 102,709,557 C99W probably damaging Het
Olfr836 T A 9: 19,121,010 H15Q probably null Het
Oraov1 T C 7: 144,928,978 probably null Het
Pcdhgb2 A G 18: 37,692,322 T789A probably benign Het
Pcyt2 T C 11: 120,611,174 D321G probably benign Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rbbp8 A T 18: 11,721,782 K355* probably null Het
Rhag T C 17: 40,836,467 Y407H probably damaging Het
Robo4 G A 9: 37,403,199 V161M probably damaging Het
Rpl27-ps3 C A 18: 6,332,922 N97K probably benign Het
Slc45a4 A G 15: 73,582,075 I691T possibly damaging Het
Slc9a9 A T 9: 94,936,449 probably benign Het
Spata5 T G 3: 37,458,325 F713C probably damaging Het
Stard13 A G 5: 151,060,815 F619L probably benign Het
Stt3b A T 9: 115,254,794 V438E probably damaging Het
Tacr3 C T 3: 134,829,421 T50I probably benign Het
Tacr3 G T 3: 134,929,929 C298F probably damaging Het
Taok3 C T 5: 117,228,066 T394M probably benign Het
Tctex1d1 T A 4: 103,004,229 I136K probably damaging Het
Tgfb1i1 A G 7: 128,249,176 D128G probably damaging Het
Tgfbr3l G T 8: 4,250,574 V251L probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Top3a A G 11: 60,742,412 S953P probably benign Het
Trappc10 T C 10: 78,197,863 K957E probably damaging Het
Ttn T A 2: 76,735,324 E28228V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vdr A T 15: 97,858,920 probably null Het
Zfp42 A T 8: 43,296,131 L111Q probably damaging Het
Other mutations in Itln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Itln1 APN 1 171534780 missense probably benign
IGL01817:Itln1 APN 1 171529160 missense probably damaging 1.00
IGL02440:Itln1 APN 1 171531529 missense probably benign 0.07
IGL03204:Itln1 APN 1 171530604 missense probably damaging 0.99
R0331:Itln1 UTSW 1 171531549 missense probably damaging 0.99
R0881:Itln1 UTSW 1 171533381 missense probably benign
R0971:Itln1 UTSW 1 171529204 missense probably damaging 0.98
R1168:Itln1 UTSW 1 171531551 nonsense probably null
R2219:Itln1 UTSW 1 171531547 missense probably damaging 1.00
R2504:Itln1 UTSW 1 171529159 missense probably damaging 1.00
R4230:Itln1 UTSW 1 171534807 missense probably benign 0.00
R5011:Itln1 UTSW 1 171533390 nonsense probably null
R5013:Itln1 UTSW 1 171533390 nonsense probably null
R5756:Itln1 UTSW 1 171516917 unclassified probably benign
R5806:Itln1 UTSW 1 171531152 missense possibly damaging 0.93
R6651:Itln1 UTSW 1 171518372 missense possibly damaging 0.56
R6703:Itln1 UTSW 1 171530583 missense probably damaging 1.00
X0019:Itln1 UTSW 1 171530571 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCTTGGCTCAAATGTTCTAAGAG -3'
(R):5'- TATCTGAGCATGGCTGGAGC -3'

Sequencing Primer
(F):5'- GGAAATATGGGTCACAAGC -3'
(R):5'- TCTGCTGAGCACTGTGC -3'
Posted On2015-10-21