Incidental Mutation 'R4695:Stard13'
ID355616
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
MMRRC Submission 042016-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4695 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151060815 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 619 (F619L)
Ref Sequence ENSEMBL: ENSMUSP00000106109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202365]
Predicted Effect probably benign
Transcript: ENSMUST00000062015
AA Change: F619L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: F619L

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110483
AA Change: F619L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: F619L

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129088
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201680
Predicted Effect probably benign
Transcript: ENSMUST00000202111
AA Change: F501L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: F501L

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202385
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts10 T A 17: 33,531,739 M251K possibly damaging Het
Adcy2 A T 13: 68,727,843 H513Q possibly damaging Het
Ahctf1 A G 1: 179,753,054 L1861P possibly damaging Het
Apc2 C A 10: 80,311,043 R615S probably damaging Het
Arhgap45 A C 10: 80,025,530 D509A probably damaging Het
Atp6v1c2 T C 12: 17,301,207 T108A probably benign Het
Blm T A 7: 80,494,228 D821V probably damaging Het
C3 T A 17: 57,221,057 I721L probably benign Het
Ccdc13 A T 9: 121,820,760 V207E probably damaging Het
Ccndbp1 C T 2: 121,014,727 probably benign Het
Cd180 A C 13: 102,705,760 Q438P probably benign Het
Cd248 C T 19: 5,068,445 T107M probably damaging Het
Cdan1 G A 2: 120,728,383 R445C probably damaging Het
Cic C A 7: 25,273,588 H915N possibly damaging Het
Cox8c T C 12: 102,899,483 S40P possibly damaging Het
Cyp2d34 A T 15: 82,616,891 C347S probably benign Het
Dhx30 A T 9: 110,085,288 F974I probably damaging Het
Dlec1 A T 9: 119,143,153 T1414S probably benign Het
Dlg2 C A 7: 92,437,962 probably null Het
Dzip1l T A 9: 99,647,205 M329K probably benign Het
Dzip3 A T 16: 48,951,561 L582I probably damaging Het
Emilin2 T C 17: 71,252,778 Y1068C probably damaging Het
Fam221b T A 4: 43,659,622 probably null Het
Fbxw22 A G 9: 109,378,871 I444T probably damaging Het
Flnc T A 6: 29,440,429 N245K probably damaging Het
Fnip1 T A 11: 54,499,419 I380N probably damaging Het
Gbf1 C T 19: 46,259,167 R181* probably null Het
Igkv6-17 T A 6: 70,371,502 F12I probably benign Het
Itln1 C A 1: 171,531,077 G174V probably damaging Het
Lrrc52 A G 1: 167,466,091 probably null Het
Matn2 A G 15: 34,402,925 Y432C probably damaging Het
Metap1d A G 2: 71,524,961 *336W probably null Het
Mgam2-ps T A 6: 40,802,555 noncoding transcript Het
Mrps9 T A 1: 42,862,515 V61D possibly damaging Het
Myh7b T C 2: 155,614,177 Y161H probably damaging Het
Myh9 T A 15: 77,768,853 D1428V probably damaging Het
N4bp3 A T 11: 51,644,479 probably null Het
Nat9 T A 11: 115,184,590 Q75L probably benign Het
Nop2 T C 6: 125,144,556 V767A probably benign Het
Ntrk2 A G 13: 59,126,493 K728E probably damaging Het
Olfr497 G A 7: 108,422,989 M139I probably benign Het
Olfr558 T G 7: 102,709,557 C99W probably damaging Het
Olfr836 T A 9: 19,121,010 H15Q probably null Het
Oraov1 T C 7: 144,928,978 probably null Het
Pcdhgb2 A G 18: 37,692,322 T789A probably benign Het
Pcyt2 T C 11: 120,611,174 D321G probably benign Het
Rad9a G A 19: 4,200,561 R85C probably damaging Het
Rbbp8 A T 18: 11,721,782 K355* probably null Het
Rhag T C 17: 40,836,467 Y407H probably damaging Het
Robo4 G A 9: 37,403,199 V161M probably damaging Het
Rpl27-ps3 C A 18: 6,332,922 N97K probably benign Het
Slc45a4 A G 15: 73,582,075 I691T possibly damaging Het
Slc9a9 A T 9: 94,936,449 probably benign Het
Spata5 T G 3: 37,458,325 F713C probably damaging Het
Stt3b A T 9: 115,254,794 V438E probably damaging Het
Tacr3 C T 3: 134,829,421 T50I probably benign Het
Tacr3 G T 3: 134,929,929 C298F probably damaging Het
Taok3 C T 5: 117,228,066 T394M probably benign Het
Tctex1d1 T A 4: 103,004,229 I136K probably damaging Het
Tgfb1i1 A G 7: 128,249,176 D128G probably damaging Het
Tgfbr3l G T 8: 4,250,574 V251L probably benign Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Top3a A G 11: 60,742,412 S953P probably benign Het
Trappc10 T C 10: 78,197,863 K957E probably damaging Het
Ttn T A 2: 76,735,324 E28228V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Vdr A T 15: 97,858,920 probably null Het
Zfp42 A T 8: 43,296,131 L111Q probably damaging Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAGACAGTGCTCCGTTCTC -3'
(R):5'- GCTTGCTAAGTCCACAGCTC -3'

Sequencing Primer
(F):5'- GACAGTGCTCCGTTCTCCAGAC -3'
(R):5'- GTAGCCATTCTTACCTAAAGGCTAGC -3'
Posted On2015-10-21