Incidental Mutation 'R4696:Acaca'
ID355717
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission 041946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4696 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84280435 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1165 (V1165A)
Ref Sequence ENSEMBL: ENSMUSP00000099490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020843
AA Change: V1165A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: V1165A

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103201
AA Change: V1165A

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: V1165A

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183887
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik G A 7: 4,151,615 P58L possibly damaging Het
Abcc3 T C 11: 94,350,991 S1405G probably benign Het
Acin1 C A 14: 54,643,017 probably benign Het
Akr1b8 G A 6: 34,363,377 V159I probably benign Het
Alms1 T C 6: 85,620,522 Y777H probably damaging Het
Cblc C A 7: 19,796,482 G101C probably damaging Het
Cic A G 7: 25,288,483 N1532S probably benign Het
Cipc T A 12: 86,952,940 probably benign Het
Clca4b T C 3: 144,911,385 I835V probably benign Het
Cntrob C T 11: 69,320,888 G170D probably damaging Het
Col14a1 A G 15: 55,372,602 Q304R unknown Het
Csmd3 T C 15: 47,913,968 T1181A probably benign Het
Dchs1 A G 7: 105,764,627 F994L probably damaging Het
Ddx42 C A 11: 106,247,703 A776D probably benign Het
Ddx58 A G 4: 40,203,798 probably benign Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dmpk A T 7: 19,088,214 N366Y probably damaging Het
Dmrt1 A G 19: 25,603,310 Y362C possibly damaging Het
Dock10 C T 1: 80,515,613 G1880D possibly damaging Het
Dzip1l A G 9: 99,663,611 R638G possibly damaging Het
Dzip3 T A 16: 48,925,969 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Eno4 T C 19: 58,945,636 S90P probably damaging Het
Epn2 C G 11: 61,535,303 A283P probably damaging Het
Eya3 T A 4: 132,670,232 Y67* probably null Het
Fat2 T C 11: 55,285,015 N1624S probably benign Het
Fez1 T A 9: 36,870,470 probably null Het
Fgfr1 T C 8: 25,563,488 S260P probably damaging Het
Glb1 A G 9: 114,464,152 S532G probably benign Het
Gm15455 A T 1: 33,837,793 noncoding transcript Het
Grid2ip A G 5: 143,391,376 probably benign Het
Guca2b C A 4: 119,656,799 G129V probably damaging Het
Hes3 T C 4: 152,287,667 E65G probably damaging Het
Itgbl1 T C 14: 123,966,708 C404R probably damaging Het
Kansl1 C T 11: 104,356,767 V586I possibly damaging Het
Krt18 A G 15: 102,031,858 D390G probably benign Het
Laptm5 T C 4: 130,933,671 probably benign Het
Lgals3bp C T 11: 118,398,151 E116K probably benign Het
Lrrc39 C T 3: 116,570,120 S114F probably damaging Het
Mfap3 T C 11: 57,528,291 probably null Het
Nphp3 A G 9: 104,022,732 H481R probably benign Het
Ntm T C 9: 29,179,205 T73A possibly damaging Het
Olfr1026 T A 2: 85,918,871 probably null Het
Olfr967 T A 9: 39,750,728 M114K probably damaging Het
Pbk G A 14: 65,811,937 C21Y probably benign Het
Pglyrp1 A G 7: 18,884,946 E74G probably benign Het
R3hdm1 G T 1: 128,236,766 probably benign Het
Rap1gds1 T C 3: 138,927,614 T599A probably damaging Het
Rims1 A T 1: 22,288,612 M1273K probably damaging Het
Sbf1 G A 15: 89,303,112 R721* probably null Het
Slc17a1 T C 13: 23,880,717 I388T probably damaging Het
Sprn A C 7: 140,153,556 probably benign Het
Tango6 T C 8: 106,700,231 V459A possibly damaging Het
Tert C T 13: 73,627,820 T230I probably benign Het
Thada T C 17: 84,426,186 D1011G possibly damaging Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trip11 A T 12: 101,885,290 N838K possibly damaging Het
Ttn A G 2: 76,767,653 W19639R probably damaging Het
Ubr4 T A 4: 139,408,672 S924T probably benign Het
Upb1 A G 10: 75,415,027 E110G probably benign Het
Vegfa C T 17: 46,028,346 probably null Het
Vmn1r231 T C 17: 20,890,639 K5E possibly damaging Het
Vmn2r16 A T 5: 109,339,302 I130F probably benign Het
Wscd2 T A 5: 113,551,179 V82E probably benign Het
Zfp462 A G 4: 55,008,612 T193A probably benign Het
Zfp467 A G 6: 48,439,357 probably benign Het
Zfp619 T C 7: 39,536,988 L814P probably benign Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 unclassified probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4821:Acaca UTSW 11 84294987 missense possibly damaging 0.69
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTTTAAGGGTCTTGCAC -3'
(R):5'- AGGGTTCATTCAAGTCTGCCC -3'

Sequencing Primer
(F):5'- GCACCCTCTTACCTCACGG -3'
(R):5'- GGGTTCATTCAAGTCTGCCCATTTG -3'
Posted On2015-10-21