Incidental Mutation 'R4696:Vegfa'
ID355738
Institutional Source Beutler Lab
Gene Symbol Vegfa
Ensembl Gene ENSMUSG00000023951
Gene Namevascular endothelial growth factor A
SynonymsVEGF-A, VPF, VEGF164, VEGF120, VEGF188, Vegf
MMRRC Submission 041946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4696 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46016993-46032369 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 46028346 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024747] [ENSMUST00000071648] [ENSMUST00000113519] [ENSMUST00000113520] [ENSMUST00000142351] [ENSMUST00000167860] [ENSMUST00000214739] [ENSMUST00000217017]
Predicted Effect probably null
Transcript: ENSMUST00000024747
SMART Domains Protein: ENSMUSP00000024747
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000071648
SMART Domains Protein: ENSMUSP00000071575
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 312 368 2.3e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113519
SMART Domains Protein: ENSMUSP00000109147
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
low complexity region 140 161 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113520
SMART Domains Protein: ENSMUSP00000109148
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
PDGF 49 131 1.48e-49 SMART
Pfam:VEGF_C 154 208 9.5e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142321
Predicted Effect probably null
Transcript: ENSMUST00000142351
SMART Domains Protein: ENSMUSP00000115883
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Pfam:VEGF_C 339 392 1.9e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150327
Predicted Effect probably null
Transcript: ENSMUST00000167860
SMART Domains Protein: ENSMUSP00000131901
Gene: ENSMUSG00000023951

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
low complexity region 60 71 N/A INTRINSIC
low complexity region 87 105 N/A INTRINSIC
low complexity region 121 143 N/A INTRINSIC
low complexity region 158 176 N/A INTRINSIC
PDGF 227 309 1.48e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000214739
Predicted Effect probably null
Transcript: ENSMUST00000217017
Meta Mutation Damage Score 0.6144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site.[provided by RefSeq, Nov 2015]
PHENOTYPE: Hetero- or homozygous null mutants show embryonic lethality with impaired angiogenesis and blood-island formation. Mutants selectively expressing isoform 120 or 188 exhibit vascular outgrowth/patterning defects or impaired arterial development, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik G A 7: 4,151,615 P58L possibly damaging Het
Abcc3 T C 11: 94,350,991 S1405G probably benign Het
Acaca T C 11: 84,280,435 V1165A possibly damaging Het
Acin1 C A 14: 54,643,017 probably benign Het
Akr1b8 G A 6: 34,363,377 V159I probably benign Het
Alms1 T C 6: 85,620,522 Y777H probably damaging Het
Cblc C A 7: 19,796,482 G101C probably damaging Het
Cic A G 7: 25,288,483 N1532S probably benign Het
Cipc T A 12: 86,952,940 probably benign Het
Clca4b T C 3: 144,911,385 I835V probably benign Het
Cntrob C T 11: 69,320,888 G170D probably damaging Het
Col14a1 A G 15: 55,372,602 Q304R unknown Het
Csmd3 T C 15: 47,913,968 T1181A probably benign Het
Dchs1 A G 7: 105,764,627 F994L probably damaging Het
Ddx42 C A 11: 106,247,703 A776D probably benign Het
Ddx58 A G 4: 40,203,798 probably benign Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dmpk A T 7: 19,088,214 N366Y probably damaging Het
Dmrt1 A G 19: 25,603,310 Y362C possibly damaging Het
Dock10 C T 1: 80,515,613 G1880D possibly damaging Het
Dzip1l A G 9: 99,663,611 R638G possibly damaging Het
Dzip3 T A 16: 48,925,969 probably benign Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Eno4 T C 19: 58,945,636 S90P probably damaging Het
Epn2 C G 11: 61,535,303 A283P probably damaging Het
Eya3 T A 4: 132,670,232 Y67* probably null Het
Fat2 T C 11: 55,285,015 N1624S probably benign Het
Fez1 T A 9: 36,870,470 probably null Het
Fgfr1 T C 8: 25,563,488 S260P probably damaging Het
Glb1 A G 9: 114,464,152 S532G probably benign Het
Gm15455 A T 1: 33,837,793 noncoding transcript Het
Grid2ip A G 5: 143,391,376 probably benign Het
Guca2b C A 4: 119,656,799 G129V probably damaging Het
Hes3 T C 4: 152,287,667 E65G probably damaging Het
Itgbl1 T C 14: 123,966,708 C404R probably damaging Het
Kansl1 C T 11: 104,356,767 V586I possibly damaging Het
Krt18 A G 15: 102,031,858 D390G probably benign Het
Laptm5 T C 4: 130,933,671 probably benign Het
Lgals3bp C T 11: 118,398,151 E116K probably benign Het
Lrrc39 C T 3: 116,570,120 S114F probably damaging Het
Mfap3 T C 11: 57,528,291 probably null Het
Nphp3 A G 9: 104,022,732 H481R probably benign Het
Ntm T C 9: 29,179,205 T73A possibly damaging Het
Olfr1026 T A 2: 85,918,871 probably null Het
Olfr967 T A 9: 39,750,728 M114K probably damaging Het
Pbk G A 14: 65,811,937 C21Y probably benign Het
Pglyrp1 A G 7: 18,884,946 E74G probably benign Het
R3hdm1 G T 1: 128,236,766 probably benign Het
Rap1gds1 T C 3: 138,927,614 T599A probably damaging Het
Rims1 A T 1: 22,288,612 M1273K probably damaging Het
Sbf1 G A 15: 89,303,112 R721* probably null Het
Slc17a1 T C 13: 23,880,717 I388T probably damaging Het
Sprn A C 7: 140,153,556 probably benign Het
Tango6 T C 8: 106,700,231 V459A possibly damaging Het
Tert C T 13: 73,627,820 T230I probably benign Het
Thada T C 17: 84,426,186 D1011G possibly damaging Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trip11 A T 12: 101,885,290 N838K possibly damaging Het
Ttn A G 2: 76,767,653 W19639R probably damaging Het
Ubr4 T A 4: 139,408,672 S924T probably benign Het
Upb1 A G 10: 75,415,027 E110G probably benign Het
Vmn1r231 T C 17: 20,890,639 K5E possibly damaging Het
Vmn2r16 A T 5: 109,339,302 I130F probably benign Het
Wscd2 T A 5: 113,551,179 V82E probably benign Het
Zfp462 A G 4: 55,008,612 T193A probably benign Het
Zfp467 A G 6: 48,439,357 probably benign Het
Zfp619 T C 7: 39,536,988 L814P probably benign Het
Other mutations in Vegfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Vegfa APN 17 46025421 missense possibly damaging 0.88
IGL02859:Vegfa APN 17 46024495 missense probably benign 0.43
R1442:Vegfa UTSW 17 46025492 missense possibly damaging 0.85
R1760:Vegfa UTSW 17 46025469 missense probably damaging 1.00
R1982:Vegfa UTSW 17 46018860 makesense probably null
R2012:Vegfa UTSW 17 46025358 missense probably benign 0.21
R3729:Vegfa UTSW 17 46024520 missense possibly damaging 0.80
R4276:Vegfa UTSW 17 46031466 missense probably benign
R4277:Vegfa UTSW 17 46031466 missense probably benign
R4279:Vegfa UTSW 17 46031466 missense probably benign
R4654:Vegfa UTSW 17 46025250 intron probably benign
X0026:Vegfa UTSW 17 46025526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAAGTCCTGTTTCTAGCAGAAAG -3'
(R):5'- TGACCCTGTGTGACTCAGAAG -3'

Sequencing Primer
(F):5'- GTCCTGTTTCTAGCAGAAAGCAGAAC -3'
(R):5'- CTGTGTGACTCAGAAGCCTGG -3'
Posted On2015-10-21