Incidental Mutation 'R4697:Gnas'
ID355754
Institutional Source Beutler Lab
Gene Symbol Gnas
Ensembl Gene ENSMUSG00000027523
Gene NameGNAS (guanine nucleotide binding protein, alpha stimulating) complex locus
SynonymsGnasxl, C130027O20Rik, 5530400H20Rik, Nespl, Nesp, A930027G11Rik, Gs alpha, G alpha s, Gsa, Nesp55, Galphas, Gnas1, P1, Gs-alpha, XLalphas, P3, neuroendocrine-specific Golgi protein p55 isoform 1, Oedsml, P2
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4697 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174284320-174346744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 174298080 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 14 (D14V)
Ref Sequence ENSEMBL: ENSMUSP00000139839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080493] [ENSMUST00000087876] [ENSMUST00000087877] [ENSMUST00000109088] [ENSMUST00000109095] [ENSMUST00000109096] [ENSMUST00000130761] [ENSMUST00000130940] [ENSMUST00000180362] [ENSMUST00000185956] [ENSMUST00000186907]
Predicted Effect silent
Transcript: ENSMUST00000080493
SMART Domains Protein: ENSMUSP00000079341
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect silent
Transcript: ENSMUST00000087876
SMART Domains Protein: ENSMUSP00000085184
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 2.42e-8 PROSPERO
internal_repeat_1 209 276 2.42e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1118 8.32e-191 SMART
Predicted Effect silent
Transcript: ENSMUST00000087877
SMART Domains Protein: ENSMUSP00000085185
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 1.1e-8 PROSPERO
internal_repeat_1 209 276 1.1e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
Blast:G_alpha 759 799 2e-14 BLAST
low complexity region 802 816 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109088
AA Change: D14V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104716
Gene: ENSMUSG00000027523
AA Change: D14V

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109095
SMART Domains Protein: ENSMUSP00000104723
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109096
SMART Domains Protein: ENSMUSP00000104724
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130761
Predicted Effect probably benign
Transcript: ENSMUST00000130940
SMART Domains Protein: ENSMUSP00000118210
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 59 1.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154658
Predicted Effect probably benign
Transcript: ENSMUST00000180362
SMART Domains Protein: ENSMUSP00000136180
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184327
Predicted Effect silent
Transcript: ENSMUST00000185956
SMART Domains Protein: ENSMUSP00000140174
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186907
AA Change: D14V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139839
Gene: ENSMUSG00000027523
AA Change: D14V

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mutant homozygotes stop developing normally by embryonic day 10.5 and die prenatally. On some backgrounds heterozygotes show imprinted phenotypes, including differences in body shape/weight, locomotor activity, metabolism, and developmental anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Gnas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gnas APN 2 174341711 splice site probably benign
IGL00928:Gnas APN 2 174297953 nonsense probably null
IGL01014:Gnas APN 2 174297974 utr 5 prime probably benign
IGL01743:Gnas APN 2 174298332 nonsense probably null
IGL01808:Gnas APN 2 174298697 missense probably damaging 0.96
IGL02559:Gnas APN 2 174341936 splice site probably benign
R0555:Gnas UTSW 2 174298511 missense possibly damaging 0.78
R0627:Gnas UTSW 2 174298135 intron probably benign
R1418:Gnas UTSW 2 174345214 splice site probably benign
R1706:Gnas UTSW 2 174299975 missense possibly damaging 0.90
R1751:Gnas UTSW 2 174297894 utr 5 prime probably benign
R1968:Gnas UTSW 2 174298733 missense probably damaging 0.96
R2290:Gnas UTSW 2 174300010 missense probably benign 0.09
R4125:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4128:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4888:Gnas UTSW 2 174298089 missense possibly damaging 0.94
R5458:Gnas UTSW 2 174298331 missense probably benign 0.41
R5640:Gnas UTSW 2 174284971 missense probably benign 0.44
R5696:Gnas UTSW 2 174299675 intron probably benign
R5757:Gnas UTSW 2 174345247 missense probably damaging 1.00
R6053:Gnas UTSW 2 174299852 missense possibly damaging 0.89
R6083:Gnas UTSW 2 174297862 start codon destroyed probably null
R6736:Gnas UTSW 2 174334251 missense probably damaging 0.98
X0022:Gnas UTSW 2 174299744 missense probably benign 0.33
Z1088:Gnas UTSW 2 174298373 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CGGCAATAATATGTCAGGACAACAC -3'
(R):5'- AAAATCGCTGGGTTGAAGGC -3'

Sequencing Primer
(F):5'- TATGTCAGGACAACACGATATCC -3'
(R):5'- CTTGGAGGCCTGATGGGGTC -3'
Posted On2015-10-21