Incidental Mutation 'R4697:Vmn2r79'
ID355777
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4697 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87037960 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 850 (I850F)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect probably damaging
Transcript: ENSMUST00000164462
AA Change: I850F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: I850F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCATGCTGGTGTTCTGC -3'
(R):5'- GTGCCTGTTGACATGTTTTAATCC -3'

Sequencing Primer
(F):5'- CTGCAGTGTCTGGATCACC -3'
(R):5'- TAATCCAATGGACTGATGGCCTC -3'
Posted On2015-10-21