Incidental Mutation 'R4697:Bicc1'
ID355786
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4697 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70953484 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 366 (I366F)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014473
AA Change: I366F

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: I366F

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131445
AA Change: I284F

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: I284F

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143791
AA Change: I366F

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: I366F

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Pdcd11 T C 19: 47,126,347 V1367A possibly damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAAATTACCAAGTCAGATGTGG -3'
(R):5'- ACACCCTCCTTGCTGTGAAG -3'

Sequencing Primer
(F):5'- TAACGGAGGGGGCACTGTTAC -3'
(R):5'- CCTCCTTGCTGTGAAGAGGTAAATG -3'
Posted On2015-10-21