Incidental Mutation 'R0211:Tmem63b'
ID35580
Institutional Source Beutler Lab
Gene Symbol Tmem63b
Ensembl Gene ENSMUSG00000036026
Gene Nametransmembrane protein 63b
Synonyms
MMRRC Submission 038462-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.659) question?
Stock #R0211 (G1)
Quality Score150
Status Not validated
Chromosome17
Chromosomal Location45660171-45686905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45661913 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 652 (M652L)
Ref Sequence ENSEMBL: ENSMUSP00000109151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113523] [ENSMUST00000120717] [ENSMUST00000151350]
Predicted Effect probably benign
Transcript: ENSMUST00000113523
AA Change: M652L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109151
Gene: ENSMUSG00000036026
AA Change: M652L

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
Pfam:RSN1_TM 101 226 2.5e-23 PFAM
Pfam:PHM7_cyt 274 344 9.1e-10 PFAM
Pfam:RSN1_7TM 362 706 5.3e-96 PFAM
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120717
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129177
Predicted Effect probably benign
Transcript: ENSMUST00000151350
SMART Domains Protein: ENSMUSP00000119679
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
Pfam:Peptidase_C2 94 153 1.5e-14 PFAM
low complexity region 163 174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156224
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,216,096 L1401P possibly damaging Het
4930503B20Rik C T 3: 146,650,496 R219H probably benign Het
Abcc9 T A 6: 142,688,984 I185F probably benign Het
Adgrf1 T C 17: 43,296,690 L100P probably damaging Het
Akt1 T C 12: 112,655,142 T407A probably damaging Het
Alk C T 17: 72,603,516 R65H probably damaging Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Arhgef12 G A 9: 42,972,004 R1411C probably damaging Het
Arnt T A 3: 95,476,149 M242K probably damaging Het
Atad5 T G 11: 80,095,647 V520G probably benign Het
Avpr1a T A 10: 122,449,469 M222K possibly damaging Het
Cbr2 T A 11: 120,730,788 I88L probably benign Het
Cc2d2a T A 5: 43,688,266 probably null Het
Ccdc51 T C 9: 109,089,373 M10T probably benign Het
Cntnap5b T A 1: 100,478,374 D1136E possibly damaging Het
Coil T A 11: 88,982,153 S447T probably damaging Het
Cryba1 T A 11: 77,718,867 Y179F probably damaging Het
Dcaf4 T A 12: 83,535,961 F277I probably damaging Het
Ddost G A 4: 138,309,602 V159M probably damaging Het
Dnajb6 T C 5: 29,785,079 probably benign Het
Dnase2a A G 8: 84,908,788 probably benign Het
Dscam T C 16: 96,716,079 I877V possibly damaging Het
Dyx1c1 A T 9: 72,961,367 R127S possibly damaging Het
Efcc1 A T 6: 87,749,154 T312S probably benign Het
Ermard A T 17: 15,021,943 Q127L probably damaging Het
F2 T C 2: 91,630,158 E329G probably damaging Het
Foxc2 T A 8: 121,116,616 M1K probably null Het
Fuz T A 7: 44,899,022 probably null Het
Ggnbp2 G A 11: 84,840,313 T325M probably damaging Het
Gm6408 T A 5: 146,483,060 F115I probably benign Het
Gm8909 T C 17: 36,168,007 T117A probably damaging Het
Gp6 C T 7: 4,373,209 probably null Het
Grin2a A G 16: 9,579,173 S1017P possibly damaging Het
Hmmr A T 11: 40,714,808 M318K probably damaging Het
Ifi205 T C 1: 174,028,428 E12G probably benign Het
Ift74 C T 4: 94,679,255 T395I probably benign Het
Ikbkap T A 4: 56,795,545 I143F probably damaging Het
Irf8 A T 8: 120,739,975 D53V probably damaging Het
Itgad A G 7: 128,204,641 Y69C probably damaging Het
Itpr2 C A 6: 146,194,613 R2084L probably benign Het
Krt4 C A 15: 101,922,782 S228I possibly damaging Het
Lpin3 A T 2: 160,898,681 D382V probably damaging Het
Ltbp3 T C 19: 5,752,143 probably null Het
Map4k3 C T 17: 80,644,841 A179T probably damaging Het
Nck1 A T 9: 100,497,767 W144R probably damaging Het
Ndufb9 A T 15: 58,939,282 Q139L possibly damaging Het
Ngfr T G 11: 95,571,912 E300A probably damaging Het
Nin T G 12: 70,014,875 T2072P probably damaging Het
Nop2 T G 6: 125,141,344 L529R probably damaging Het
Nrm T A 17: 35,864,611 L203Q probably damaging Het
Nynrin T C 14: 55,871,798 F1454S probably benign Het
Olfr1062 A C 2: 86,423,107 S190A probably damaging Het
Olfr1328 T A 4: 118,934,270 M191L probably benign Het
Olfr1453 T C 19: 13,028,282 T16A possibly damaging Het
Os9 A G 10: 127,121,036 V27A probably damaging Het
Osbpl9 T G 4: 109,073,124 T332P probably damaging Het
Pcdhb10 A T 18: 37,414,006 M712L probably benign Het
Pcx C T 19: 4,620,199 A935V probably damaging Het
Pdzd7 A G 19: 45,033,667 V514A possibly damaging Het
Plin4 C T 17: 56,102,242 G1326D probably damaging Het
Plxnb1 T A 9: 109,103,663 Y568* probably null Het
Pmfbp1 T A 8: 109,541,740 V973D probably benign Het
Ppp2r1b T C 9: 50,861,625 V70A probably benign Het
Prkar2b C A 12: 31,972,184 V201L probably benign Het
Rgr T G 14: 37,046,968 T37P probably damaging Het
Ripk3 A T 14: 55,787,918 L63Q probably damaging Het
Rpusd2 A G 2: 119,038,412 S439G probably benign Het
Serac1 T A 17: 6,050,060 R438S possibly damaging Het
Slc19a1 T A 10: 77,038,466 S24T possibly damaging Het
Slc6a21 A C 7: 45,288,243 T653P possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spdef C T 17: 27,714,920 R309H probably damaging Het
Srp68 A T 11: 116,265,551 Y84N probably damaging Het
Syne2 A T 12: 76,097,957 Q6299L probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnk1 A G 11: 69,855,181 V306A probably damaging Het
Tnnc2 T A 2: 164,777,484 I147F probably damaging Het
Tnni3k C T 3: 155,055,344 probably benign Het
Togaram2 T A 17: 71,729,248 V911D probably damaging Het
Tyw3 T C 3: 154,587,495 N181S probably damaging Het
Unc79 T A 12: 103,072,792 S682T probably benign Het
Vps13d A G 4: 145,114,778 L2634S probably benign Het
Wasl G T 6: 24,633,893 A124E probably damaging Het
Zfp287 T C 11: 62,714,917 H388R probably damaging Het
Zfp335 T C 2: 164,907,692 T262A probably damaging Het
Zfp457 C G 13: 67,293,147 G359R probably benign Het
Zfp536 T A 7: 37,568,449 E514V probably damaging Het
Zfp872 T A 9: 22,200,173 I316N probably damaging Het
Other mutations in Tmem63b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Tmem63b APN 17 45663571 missense probably damaging 1.00
IGL02486:Tmem63b APN 17 45673983 missense probably damaging 0.97
IGL02519:Tmem63b APN 17 45665208 missense possibly damaging 0.46
IGL02893:Tmem63b APN 17 45661900 missense probably damaging 1.00
IGL03137:Tmem63b APN 17 45664995 missense probably damaging 0.98
R0211:Tmem63b UTSW 17 45661913 missense probably benign 0.00
R0276:Tmem63b UTSW 17 45675373 splice site probably benign
R0441:Tmem63b UTSW 17 45666315 critical splice donor site probably null
R0729:Tmem63b UTSW 17 45674134 missense probably damaging 1.00
R0749:Tmem63b UTSW 17 45666115 missense possibly damaging 0.89
R0834:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0835:Tmem63b UTSW 17 45660944 missense possibly damaging 0.93
R0865:Tmem63b UTSW 17 45661519 missense probably benign 0.02
R1144:Tmem63b UTSW 17 45666427 missense probably benign 0.07
R1448:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1468:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1538:Tmem63b UTSW 17 45678978 missense possibly damaging 0.89
R1853:Tmem63b UTSW 17 45661297 missense possibly damaging 0.68
R1935:Tmem63b UTSW 17 45678961 critical splice donor site probably null
R2078:Tmem63b UTSW 17 45663536 missense possibly damaging 0.91
R2518:Tmem63b UTSW 17 45666154 missense probably benign
R3911:Tmem63b UTSW 17 45677958 missense probably damaging 1.00
R5093:Tmem63b UTSW 17 45660874 missense probably damaging 1.00
R5186:Tmem63b UTSW 17 45661477 missense possibly damaging 0.68
R5364:Tmem63b UTSW 17 45664727 unclassified probably benign
R5396:Tmem63b UTSW 17 45669962 missense possibly damaging 0.72
R5548:Tmem63b UTSW 17 45664958 missense probably damaging 0.98
R5582:Tmem63b UTSW 17 45667763 missense probably benign
R5998:Tmem63b UTSW 17 45670000 missense possibly damaging 0.94
R6198:Tmem63b UTSW 17 45661516 missense probably benign 0.00
R6656:Tmem63b UTSW 17 45667708 missense probably benign
R6808:Tmem63b UTSW 17 45660808 missense probably benign 0.13
R6967:Tmem63b UTSW 17 45666632 missense probably benign 0.00
R7089:Tmem63b UTSW 17 45667783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAGGCTCTTCTGTCCCTGACAC -3'
(R):5'- TGCAGGCAAGCCATGTAACTTGG -3'

Sequencing Primer
(F):5'- TGACACTGGTCCCAGGC -3'
(R):5'- GGAGTAGAACCTGCCCTTTAG -3'
Posted On2013-05-09