Incidental Mutation 'R4697:Pdcd11'
ID355808
Institutional Source Beutler Lab
Gene Symbol Pdcd11
Ensembl Gene ENSMUSG00000025047
Gene Nameprogrammed cell death 11
SynonymsALG-4, 1110021I22Rik
MMRRC Submission 041947-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R4697 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47090766-47131143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47126347 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1367 (V1367A)
Ref Sequence ENSEMBL: ENSMUSP00000072008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072141] [ENSMUST00000140512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072141
AA Change: V1367A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072008
Gene: ENSMUSG00000025047
AA Change: V1367A

DomainStartEndE-ValueType
low complexity region 53 76 N/A INTRINSIC
S1 81 171 1.05e-7 SMART
S1 185 258 2.32e-9 SMART
S1 279 346 1.44e-5 SMART
S1 363 436 8.55e-8 SMART
S1 451 522 3.89e-20 SMART
S1 540 611 1.14e-17 SMART
S1 634 707 2.76e-2 SMART
S1 727 798 2.02e-18 SMART
low complexity region 813 823 N/A INTRINSIC
S1 844 911 6.13e0 SMART
Blast:S1 923 993 8e-39 BLAST
low complexity region 1018 1032 N/A INTRINSIC
S1 1045 1120 1.3e-7 SMART
S1 1158 1233 6.09e-4 SMART
S1 1239 1309 4.14e-6 SMART
S1 1333 1407 1.57e-6 SMART
low complexity region 1433 1473 N/A INTRINSIC
coiled coil region 1557 1588 N/A INTRINSIC
HAT 1591 1622 6.53e2 SMART
HAT 1624 1661 4.12e1 SMART
HAT 1663 1694 3.49e2 SMART
HAT 1696 1728 3.18e-1 SMART
HAT 1730 1764 2.25e2 SMART
HAT 1766 1798 8.52e-2 SMART
HAT 1800 1835 1.33e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PDCD11 is a NF-kappa-B (NFKB1; 164011)-binding protein that colocalizes with U3 RNA (MIM 180710) in the nucleolus and is required for rRNA maturation and generation of 18S rRNA (Sweet et al., 2003 [PubMed 14624448]; Sweet et al., 2008 [PubMed 17654514]).[supplied by OMIM, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,791,448 I455N probably damaging Het
A2m T C 6: 121,638,284 M1T probably null Het
Aatf T A 11: 84,449,138 D449V probably damaging Het
Acbd3 T A 1: 180,721,944 probably benign Het
BC005561 A G 5: 104,522,240 K1543E probably benign Het
Bicc1 T A 10: 70,953,484 I366F possibly damaging Het
Ccdc74a T C 16: 17,649,749 S184P possibly damaging Het
Cntn4 T C 6: 106,525,485 V401A probably damaging Het
Cux2 T C 5: 121,873,753 T540A probably damaging Het
Disp2 G T 2: 118,791,684 E966* probably null Het
Dpp7 A G 2: 25,354,919 Y209H probably benign Het
Dstyk T A 1: 132,449,487 F277Y probably damaging Het
Dtx1 A T 5: 120,694,408 probably null Het
Ear-ps2 G A 14: 44,047,060 noncoding transcript Het
Ednra T C 8: 77,664,995 H422R probably benign Het
Erlec1 T A 11: 30,952,640 I67F probably benign Het
Fam161b G A 12: 84,348,558 probably benign Het
Gata5 A T 2: 180,327,379 C345* probably null Het
Glmp T C 3: 88,328,274 V47A probably damaging Het
Gm9762 T A 3: 78,966,550 noncoding transcript Het
Gnas A T 2: 174,298,080 D14V probably damaging Het
Gnl3 T C 14: 31,017,329 S53G probably damaging Het
Grhl3 C T 4: 135,548,466 V527M probably damaging Het
Hoxd10 T A 2: 74,694,187 L281* probably null Het
Kif16b T G 2: 142,690,694 Y1175S probably benign Het
Kif2b A G 11: 91,576,846 S204P probably benign Het
Klhl40 T A 9: 121,778,734 I320N probably damaging Het
Ksr2 G A 5: 117,708,147 R693Q probably damaging Het
Mis12 A G 11: 71,025,326 K62E possibly damaging Het
Mlc1 A G 15: 88,974,777 C102R probably damaging Het
Muc5b T C 7: 141,857,361 I1348T unknown Het
Myh7b A G 2: 155,629,322 E1130G probably damaging Het
Nat8f4 T C 6: 85,901,386 T52A probably benign Het
Nxpe2 C A 9: 48,320,521 V379L probably benign Het
Olfr1231 C A 2: 89,302,902 S230I possibly damaging Het
Olfr1231 T A 2: 89,302,903 S230C probably damaging Het
Olfr1448 C T 19: 12,919,934 C125Y probably damaging Het
Olfr1465 A T 19: 13,313,717 D189E probably benign Het
Olfr288 G A 15: 98,186,868 R310W probably damaging Het
Pcdhga7 A T 18: 37,717,208 Y756F probably damaging Het
Pcsk6 T A 7: 65,959,241 Y284N probably damaging Het
Postn T A 3: 54,375,071 N484K probably damaging Het
Prkd3 C T 17: 78,961,171 V572I probably benign Het
Qser1 T C 2: 104,787,183 S1005G probably benign Het
Radil G T 5: 142,486,801 D951E probably benign Het
Ripk1 C T 13: 34,027,942 R352* probably null Het
Sacs T C 14: 61,212,747 F4081L probably benign Het
Sbf1 A G 15: 89,315,085 V11A possibly damaging Het
Sgip1 T A 4: 102,934,587 F536I probably damaging Het
Slc45a1 A G 4: 150,638,284 L381P probably damaging Het
Smarcad1 C T 6: 65,052,641 P71L probably benign Het
Spns1 T A 7: 126,377,037 D14V probably damaging Het
Sv2c T A 13: 95,986,018 I417F possibly damaging Het
Tas2r113 T A 6: 132,893,516 M169K probably benign Het
Tgm1 A T 14: 55,705,681 N567K probably benign Het
Tln2 C T 9: 67,395,461 R76Q probably damaging Het
Trpm6 T C 19: 18,853,791 V1340A probably benign Het
Tspan18 A T 2: 93,312,030 probably null Het
Txndc11 C T 16: 11,084,314 V679I probably damaging Het
Usf1 G T 1: 171,416,964 G144V possibly damaging Het
Vmn1r59 T C 7: 5,454,452 Y103C probably damaging Het
Vmn2r23 A T 6: 123,741,826 I713F probably damaging Het
Vmn2r79 A T 7: 87,037,960 I850F probably damaging Het
Wdr90 C T 17: 25,855,363 R676H probably benign Het
Zfp867 G A 11: 59,463,661 R281W probably damaging Het
Zfp939 T C 7: 39,472,942 noncoding transcript Het
Other mutations in Pdcd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Pdcd11 APN 19 47117328 missense possibly damaging 0.83
IGL00656:Pdcd11 APN 19 47098170 missense probably damaging 1.00
IGL00754:Pdcd11 APN 19 47103782 missense possibly damaging 0.86
IGL00907:Pdcd11 APN 19 47107564 missense probably benign 0.16
IGL00987:Pdcd11 APN 19 47114550 intron probably benign
IGL01346:Pdcd11 APN 19 47109614 missense probably benign 0.03
IGL01529:Pdcd11 APN 19 47109629 missense probably benign 0.01
IGL01670:Pdcd11 APN 19 47106304 missense probably damaging 0.98
IGL01917:Pdcd11 APN 19 47101165 missense possibly damaging 0.92
IGL02096:Pdcd11 APN 19 47106421 missense probably benign 0.10
IGL02300:Pdcd11 APN 19 47126942 missense probably benign
IGL02515:Pdcd11 APN 19 47125077 missense probably damaging 1.00
IGL02886:Pdcd11 APN 19 47113625 missense possibly damaging 0.95
IGL03158:Pdcd11 APN 19 47128061 missense possibly damaging 0.91
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0100:Pdcd11 UTSW 19 47102666 missense probably benign 0.00
R0128:Pdcd11 UTSW 19 47119862 missense probably benign 0.15
R0139:Pdcd11 UTSW 19 47110959 critical splice acceptor site probably null
R0227:Pdcd11 UTSW 19 47113437 intron probably benign
R0316:Pdcd11 UTSW 19 47113172 missense probably damaging 0.97
R0480:Pdcd11 UTSW 19 47125037 intron probably benign
R0577:Pdcd11 UTSW 19 47098832 missense probably benign 0.01
R0725:Pdcd11 UTSW 19 47127291 missense probably benign 0.17
R1344:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1418:Pdcd11 UTSW 19 47130077 missense probably damaging 1.00
R1856:Pdcd11 UTSW 19 47098187 missense probably benign 0.00
R2146:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2147:Pdcd11 UTSW 19 47104752 missense probably benign 0.00
R2447:Pdcd11 UTSW 19 47114556 missense probably benign 0.01
R2916:Pdcd11 UTSW 19 47113437 intron probably benign
R3177:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3277:Pdcd11 UTSW 19 47113264 missense probably damaging 1.00
R3712:Pdcd11 UTSW 19 47127245 intron probably benign
R4495:Pdcd11 UTSW 19 47111006 missense probably benign
R4941:Pdcd11 UTSW 19 47119886 missense probably damaging 1.00
R4953:Pdcd11 UTSW 19 47127965 missense probably benign 0.04
R5048:Pdcd11 UTSW 19 47107115 missense probably benign
R5049:Pdcd11 UTSW 19 47107115 missense probably benign
R5103:Pdcd11 UTSW 19 47124454 missense probably benign 0.00
R5107:Pdcd11 UTSW 19 47106454 missense probably damaging 1.00
R5139:Pdcd11 UTSW 19 47107115 missense probably benign
R5261:Pdcd11 UTSW 19 47113537 missense probably benign
R5302:Pdcd11 UTSW 19 47107644 missense probably damaging 1.00
R5592:Pdcd11 UTSW 19 47102725 missense probably benign
R5769:Pdcd11 UTSW 19 47102637 missense possibly damaging 0.92
R5791:Pdcd11 UTSW 19 47110991 missense possibly damaging 0.65
R5809:Pdcd11 UTSW 19 47093808 missense probably benign 0.01
R5899:Pdcd11 UTSW 19 47104759 missense possibly damaging 0.93
R5901:Pdcd11 UTSW 19 47128332 missense possibly damaging 0.76
R5947:Pdcd11 UTSW 19 47129263 missense probably benign 0.20
R6177:Pdcd11 UTSW 19 47120283 missense probably damaging 1.00
R6489:Pdcd11 UTSW 19 47109752 missense probably damaging 1.00
R6575:Pdcd11 UTSW 19 47109678 missense probably damaging 0.98
R6578:Pdcd11 UTSW 19 47111081 missense probably benign 0.11
X0065:Pdcd11 UTSW 19 47096896 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAACCAACTTTATCCTCCTGG -3'
(R):5'- GGTTTGTCACCCATCTGAACAC -3'

Sequencing Primer
(F):5'- TGGATGCCACGATCCATTG -3'
(R):5'- GTCACCCATCTGAACACTACTTG -3'
Posted On2015-10-21