Incidental Mutation 'R0211:Pcx'
ID35587
Institutional Source Beutler Lab
Gene Symbol Pcx
Ensembl Gene ENSMUSG00000024892
Gene Namepyruvate carboxylase
SynonymsPc
MMRRC Submission 038462-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0211 (G1)
Quality Score116
Status Validated (trace)
Chromosome19
Chromosomal Location4510472-4621752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4620199 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 935 (A935V)
Ref Sequence ENSEMBL: ENSMUSP00000153479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025823] [ENSMUST00000053597] [ENSMUST00000068004] [ENSMUST00000113822] [ENSMUST00000113825] [ENSMUST00000224675] [ENSMUST00000224707] [ENSMUST00000224726] [ENSMUST00000225264] [ENSMUST00000225375] [ENSMUST00000225476]
Predicted Effect probably benign
Transcript: ENSMUST00000025823
SMART Domains Protein: ENSMUSP00000025823
Gene: ENSMUSG00000024889

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
Pfam:Abi 147 267 1.4e-19 PFAM
transmembrane domain 283 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053597
SMART Domains Protein: ENSMUSP00000050039
Gene: ENSMUSG00000045045

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068004
AA Change: A936V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063825
Gene: ENSMUSG00000024892
AA Change: A936V

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:CPSase_L_chain 37 147 3.3e-45 PFAM
Pfam:ATP-grasp_4 149 334 3.9e-19 PFAM
Pfam:CPSase_L_D2 152 361 7.2e-77 PFAM
Pfam:Dala_Dala_lig_C 161 329 1.5e-11 PFAM
Biotin_carb_C 376 483 1.21e-50 SMART
low complexity region 513 541 N/A INTRINSIC
Pfam:HMGL-like 564 838 8.2e-29 PFAM
Pfam:PYC_OADA 862 1062 1.4e-72 PFAM
Pfam:Biotin_lipoyl 1111 1178 1.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113822
SMART Domains Protein: ENSMUSP00000109453
Gene: ENSMUSG00000045045

DomainStartEndE-ValueType
LRRNT 16 52 1.16e0 SMART
LRR 71 94 3.86e0 SMART
LRR_TYP 95 118 9.44e-2 SMART
LRR 120 142 1.23e0 SMART
LRR 144 166 1.09e1 SMART
LRR_TYP 168 191 7.37e-4 SMART
LRR 192 215 1.45e1 SMART
LRRCT 234 279 1.27e-3 SMART
IGc2 293 358 3.35e-14 SMART
FN3 403 484 1.77e-2 SMART
transmembrane domain 517 539 N/A INTRINSIC
low complexity region 565 585 N/A INTRINSIC
low complexity region 614 626 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113825
AA Change: A935V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109456
Gene: ENSMUSG00000024892
AA Change: A935V

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:CPSase_L_chain 36 146 1.1e-43 PFAM
Pfam:ATP-grasp_4 148 332 2.9e-19 PFAM
Pfam:CPSase_L_D2 151 360 4.2e-77 PFAM
Pfam:Dala_Dala_lig_C 158 328 7.9e-13 PFAM
Biotin_carb_C 375 482 1.21e-50 SMART
low complexity region 512 540 N/A INTRINSIC
Pfam:HMGL-like 571 821 3.4e-28 PFAM
Pfam:PYC_OADA 861 1062 3.4e-69 PFAM
Pfam:Biotin_lipoyl 1110 1177 1.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184483
Predicted Effect probably benign
Transcript: ENSMUST00000224675
Predicted Effect probably benign
Transcript: ENSMUST00000224707
Predicted Effect probably damaging
Transcript: ENSMUST00000224726
AA Change: A935V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000225264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225285
Predicted Effect probably benign
Transcript: ENSMUST00000225375
Predicted Effect probably benign
Transcript: ENSMUST00000225476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225509
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes pyruvate carboxylase, which requires biotin and ATP to catalyse the carboxylation of pyruvate to oxaloacetate. The active enzyme is a homotetramer arranged in a tetrahedron which is located exclusively in the mitochondrial matrix. Pyruvate carboxylase is involved in gluconeogenesis, lipogenesis, insulin secretion and synthesis of the neurotransmitter glutamate. Mutations in this gene have been associated with pyruvate carboxylase deficiency. Alternatively spliced transcript variants with different 5' UTRs, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,216,096 L1401P possibly damaging Het
4930503B20Rik C T 3: 146,650,496 R219H probably benign Het
Abcc9 T A 6: 142,688,984 I185F probably benign Het
Adgrf1 T C 17: 43,296,690 L100P probably damaging Het
Akt1 T C 12: 112,655,142 T407A probably damaging Het
Alk C T 17: 72,603,516 R65H probably damaging Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Arhgef12 G A 9: 42,972,004 R1411C probably damaging Het
Arnt T A 3: 95,476,149 M242K probably damaging Het
Atad5 T G 11: 80,095,647 V520G probably benign Het
Avpr1a T A 10: 122,449,469 M222K possibly damaging Het
Cbr2 T A 11: 120,730,788 I88L probably benign Het
Cc2d2a T A 5: 43,688,266 probably null Het
Ccdc51 T C 9: 109,089,373 M10T probably benign Het
Cntnap5b T A 1: 100,478,374 D1136E possibly damaging Het
Coil T A 11: 88,982,153 S447T probably damaging Het
Cryba1 T A 11: 77,718,867 Y179F probably damaging Het
Dcaf4 T A 12: 83,535,961 F277I probably damaging Het
Ddost G A 4: 138,309,602 V159M probably damaging Het
Dnajb6 T C 5: 29,785,079 probably benign Het
Dnase2a A G 8: 84,908,788 probably benign Het
Dscam T C 16: 96,716,079 I877V possibly damaging Het
Dyx1c1 A T 9: 72,961,367 R127S possibly damaging Het
Efcc1 A T 6: 87,749,154 T312S probably benign Het
Ermard A T 17: 15,021,943 Q127L probably damaging Het
F2 T C 2: 91,630,158 E329G probably damaging Het
Foxc2 T A 8: 121,116,616 M1K probably null Het
Fuz T A 7: 44,899,022 probably null Het
Ggnbp2 G A 11: 84,840,313 T325M probably damaging Het
Gm6408 T A 5: 146,483,060 F115I probably benign Het
Gm8909 T C 17: 36,168,007 T117A probably damaging Het
Gp6 C T 7: 4,373,209 probably null Het
Grin2a A G 16: 9,579,173 S1017P possibly damaging Het
Hmmr A T 11: 40,714,808 M318K probably damaging Het
Ifi205 T C 1: 174,028,428 E12G probably benign Het
Ift74 C T 4: 94,679,255 T395I probably benign Het
Ikbkap T A 4: 56,795,545 I143F probably damaging Het
Irf8 A T 8: 120,739,975 D53V probably damaging Het
Itgad A G 7: 128,204,641 Y69C probably damaging Het
Itpr2 C A 6: 146,194,613 R2084L probably benign Het
Krt4 C A 15: 101,922,782 S228I possibly damaging Het
Lpin3 A T 2: 160,898,681 D382V probably damaging Het
Ltbp3 T C 19: 5,752,143 probably null Het
Map4k3 C T 17: 80,644,841 A179T probably damaging Het
Nck1 A T 9: 100,497,767 W144R probably damaging Het
Ndufb9 A T 15: 58,939,282 Q139L possibly damaging Het
Ngfr T G 11: 95,571,912 E300A probably damaging Het
Nin T G 12: 70,014,875 T2072P probably damaging Het
Nop2 T G 6: 125,141,344 L529R probably damaging Het
Nrm T A 17: 35,864,611 L203Q probably damaging Het
Nynrin T C 14: 55,871,798 F1454S probably benign Het
Olfr1062 A C 2: 86,423,107 S190A probably damaging Het
Olfr1328 T A 4: 118,934,270 M191L probably benign Het
Olfr1453 T C 19: 13,028,282 T16A possibly damaging Het
Os9 A G 10: 127,121,036 V27A probably damaging Het
Osbpl9 T G 4: 109,073,124 T332P probably damaging Het
Pcdhb10 A T 18: 37,414,006 M712L probably benign Het
Pdzd7 A G 19: 45,033,667 V514A possibly damaging Het
Plin4 C T 17: 56,102,242 G1326D probably damaging Het
Plxnb1 T A 9: 109,103,663 Y568* probably null Het
Pmfbp1 T A 8: 109,541,740 V973D probably benign Het
Ppp2r1b T C 9: 50,861,625 V70A probably benign Het
Prkar2b C A 12: 31,972,184 V201L probably benign Het
Rgr T G 14: 37,046,968 T37P probably damaging Het
Ripk3 A T 14: 55,787,918 L63Q probably damaging Het
Rpusd2 A G 2: 119,038,412 S439G probably benign Het
Serac1 T A 17: 6,050,060 R438S possibly damaging Het
Slc19a1 T A 10: 77,038,466 S24T possibly damaging Het
Slc6a21 A C 7: 45,288,243 T653P possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spdef C T 17: 27,714,920 R309H probably damaging Het
Srp68 A T 11: 116,265,551 Y84N probably damaging Het
Syne2 A T 12: 76,097,957 Q6299L probably damaging Het
Tmem63b T A 17: 45,661,913 M652L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnk1 A G 11: 69,855,181 V306A probably damaging Het
Tnnc2 T A 2: 164,777,484 I147F probably damaging Het
Tnni3k C T 3: 155,055,344 probably benign Het
Togaram2 T A 17: 71,729,248 V911D probably damaging Het
Tyw3 T C 3: 154,587,495 N181S probably damaging Het
Unc79 T A 12: 103,072,792 S682T probably benign Het
Vps13d A G 4: 145,114,778 L2634S probably benign Het
Wasl G T 6: 24,633,893 A124E probably damaging Het
Zfp287 T C 11: 62,714,917 H388R probably damaging Het
Zfp335 T C 2: 164,907,692 T262A probably damaging Het
Zfp457 C G 13: 67,293,147 G359R probably benign Het
Zfp536 T A 7: 37,568,449 E514V probably damaging Het
Zfp872 T A 9: 22,200,173 I316N probably damaging Het
Other mutations in Pcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Pcx APN 19 4620937 missense probably benign 0.02
IGL01339:Pcx APN 19 4620235 unclassified probably null
IGL01373:Pcx APN 19 4620235 unclassified probably null
IGL01704:Pcx APN 19 4621060 missense probably damaging 1.00
IGL02223:Pcx APN 19 4601978 missense probably damaging 1.00
PIT4151001:Pcx UTSW 19 4603129 missense probably damaging 1.00
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0098:Pcx UTSW 19 4601747 splice site probably benign
R0211:Pcx UTSW 19 4620199 missense probably damaging 1.00
R0398:Pcx UTSW 19 4601610 missense probably benign 0.35
R0414:Pcx UTSW 19 4607642 missense possibly damaging 0.60
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1402:Pcx UTSW 19 4602030 missense possibly damaging 0.59
R1479:Pcx UTSW 19 4602024 missense probably damaging 1.00
R1543:Pcx UTSW 19 4602223 missense probably damaging 1.00
R1559:Pcx UTSW 19 4619086 missense probably damaging 1.00
R1607:Pcx UTSW 19 4603159 missense possibly damaging 0.89
R1833:Pcx UTSW 19 4619104 missense probably damaging 0.98
R1866:Pcx UTSW 19 4621221 missense possibly damaging 0.58
R2131:Pcx UTSW 19 4602551 missense probably benign 0.00
R2172:Pcx UTSW 19 4620881 missense probably benign 0.17
R2224:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2226:Pcx UTSW 19 4617998 missense possibly damaging 0.46
R2280:Pcx UTSW 19 4604543 missense probably damaging 1.00
R3950:Pcx UTSW 19 4617967 missense probably benign 0.00
R3952:Pcx UTSW 19 4617967 missense probably benign 0.00
R4205:Pcx UTSW 19 4619166 missense possibly damaging 0.95
R4409:Pcx UTSW 19 4610003 missense possibly damaging 0.65
R4670:Pcx UTSW 19 4619888 missense probably damaging 1.00
R4691:Pcx UTSW 19 4619477 missense probably damaging 0.99
R4728:Pcx UTSW 19 4603096 missense probably damaging 1.00
R4808:Pcx UTSW 19 4620928 missense probably benign 0.00
R5200:Pcx UTSW 19 4618504 missense probably damaging 1.00
R5454:Pcx UTSW 19 4602476 missense probably damaging 1.00
R5621:Pcx UTSW 19 4619167 missense possibly damaging 0.59
R5990:Pcx UTSW 19 4621266 missense probably damaging 1.00
R6519:Pcx UTSW 19 4602211 missense possibly damaging 0.64
R6526:Pcx UTSW 19 4604495 missense probably benign 0.44
R7202:Pcx UTSW 19 4602333 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGCTCCAAGTTCAAGGAGGTCAAG -3'
(R):5'- TTTAGCACCTGAAGAGCAAGCAGAG -3'

Sequencing Primer
(F):5'- CCTATGTGGAGGCTAACCAG -3'
(R):5'- GCAGAGGGTCAGGCCAG -3'
Posted On2013-05-09