Incidental Mutation 'R0402:Fam71a'
ID35594
Institutional Source Beutler Lab
Gene Symbol Fam71a
Ensembl Gene ENSMUSG00000091017
Gene Namefamily with sequence similarity 71, member A
Synonyms
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0402 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191162584-191164817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191164440 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000127945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171798]
Predicted Effect probably benign
Transcript: ENSMUST00000171798
AA Change: D2G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127945
Gene: ENSMUSG00000091017
AA Change: D2G

DomainStartEndE-ValueType
Pfam:DUF3699 120 193 3.6e-31 PFAM
low complexity region 214 227 N/A INTRINSIC
low complexity region 505 513 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the Rab2B small GTPase and may be important for integrity of the Golgi body. A knockdown of this gene induces fragmentation of the Golgi, similar to the effect seen with a knockdown of the Rab2B small GTPase. The encoded protein has an N-terminal Rab-binding domain specific for Rab2B. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Fam71a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fam71a APN 1 191163027 missense probably benign 0.00
IGL01541:Fam71a APN 1 191164409 nonsense probably null
IGL02364:Fam71a APN 1 191163516 missense probably benign 0.03
IGL02573:Fam71a APN 1 191163870 missense probably damaging 1.00
IGL02705:Fam71a APN 1 191164302 missense probably damaging 1.00
IGL03057:Fam71a APN 1 191162944 missense probably benign 0.01
IGL03283:Fam71a APN 1 191162832 missense probably benign 0.08
R0234:Fam71a UTSW 1 191162908 missense probably benign 0.00
R0234:Fam71a UTSW 1 191162908 missense probably benign 0.00
R0635:Fam71a UTSW 1 191163727 missense probably benign
R0750:Fam71a UTSW 1 191164485 start gained probably benign
R1118:Fam71a UTSW 1 191164485 start gained probably benign
R1521:Fam71a UTSW 1 191164022 missense probably benign 0.00
R1573:Fam71a UTSW 1 191164485 start gained probably benign
R1654:Fam71a UTSW 1 191163481 missense probably benign 0.00
R1699:Fam71a UTSW 1 191163821 missense probably benign 0.01
R1900:Fam71a UTSW 1 191164434 missense possibly damaging 0.76
R2912:Fam71a UTSW 1 191163228 missense probably benign 0.00
R2939:Fam71a UTSW 1 191163906 missense possibly damaging 0.54
R3747:Fam71a UTSW 1 191164010 missense probably damaging 1.00
R4133:Fam71a UTSW 1 191163008 missense probably benign 0.05
R6038:Fam71a UTSW 1 191162722 missense probably damaging 0.98
R6038:Fam71a UTSW 1 191162722 missense probably damaging 0.98
R7179:Fam71a UTSW 1 191164021 missense probably damaging 1.00
R7182:Fam71a UTSW 1 191163351 missense probably damaging 0.99
R7261:Fam71a UTSW 1 191164111 missense unknown
R7326:Fam71a UTSW 1 191164353 missense probably benign 0.00
R7363:Fam71a UTSW 1 191163713 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCGAATATCGGCGCGTACTTG -3'
(R):5'- TTGTAGACCCTGAAGAGAACCTCCC -3'

Sequencing Primer
(F):5'- CGGCGCGTACTTGAATATATC -3'
(R):5'- TGAAGAGAACCTCCCTGGAGTC -3'
Posted On2013-05-09