Incidental Mutation 'R4700:Abca13'
ID355943
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene NameATP-binding cassette, sub-family A (ABC1), member 13
SynonymsA930002G16Rik
MMRRC Submission 041948-MU
Accession Numbers

NCBI RefSeq: NM_178259.3; MGI:2388707

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4700 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location9191942-9684259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9292306 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1390 (T1390A)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042740
AA Change: T1390A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: T1390A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (127/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik A G 13: 31,558,812 probably benign Het
Abca14 T A 7: 120,312,705 probably null Het
Abca8a A C 11: 110,070,482 V538G probably damaging Het
Acy1 C T 9: 106,433,583 G329R probably benign Het
Adamts17 T C 7: 67,041,888 C607R probably damaging Het
Adamts20 A T 15: 94,394,622 C202* probably null Het
Adcy5 A G 16: 35,279,216 N712S possibly damaging Het
Ahnak A G 19: 9,004,681 K1110E probably benign Het
Anks6 T A 4: 47,033,127 H578L possibly damaging Het
Appl1 C A 14: 26,925,971 L626F probably benign Het
Arl1 A G 10: 88,730,637 probably benign Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
B020031M17Rik T C 13: 119,949,842 Y76C probably benign Het
Carm1 A G 9: 21,587,184 N466S probably benign Het
Cbl A G 9: 44,173,380 S153P probably damaging Het
Ccdc159 A G 9: 21,927,731 probably null Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdc7 T C 5: 106,973,841 F207L probably benign Het
Celsr2 T C 3: 108,397,231 R2271G probably benign Het
Cep162 T C 9: 87,206,862 Q989R probably damaging Het
Cep89 A G 7: 35,438,437 T749A probably benign Het
Clcn5 T C X: 7,166,352 probably null Het
Clu A T 14: 65,979,864 Y382F probably benign Het
Cnih4 A G 1: 181,166,243 probably benign Het
Crb1 A G 1: 139,198,771 L1340P probably damaging Het
D730048I06Rik A T 9: 35,789,725 C22S probably damaging Het
Ddx4 T C 13: 112,613,735 T421A probably damaging Het
Dennd5a T C 7: 109,921,198 E484G probably benign Het
Dsg4 G T 18: 20,456,908 V372L possibly damaging Het
Dyrk2 T C 10: 118,868,286 D21G probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Epb41l4a A T 18: 33,802,507 probably null Het
F10 G T 8: 13,039,621 V67F possibly damaging Het
Fat3 A G 9: 16,031,173 I1301T probably damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Flt4 C A 11: 49,626,444 probably benign Het
Fndc1 G A 17: 7,771,480 T1128I unknown Het
Fos T C 12: 85,476,162 S283P probably benign Het
Fryl T C 5: 73,065,538 Y1900C possibly damaging Het
Fsip2 C A 2: 82,987,029 Q4369K probably benign Het
Gad2 A T 2: 22,673,970 H395L probably damaging Het
Grm2 T A 9: 106,653,931 I120F probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Igsf10 A T 3: 59,320,330 I1974N probably damaging Het
Il23r T C 6: 67,473,850 N215S probably damaging Het
Jph1 T A 1: 17,091,704 M245L possibly damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lsg1 A G 16: 30,565,449 I521T probably damaging Het
Ltc4s C T 11: 50,237,081 G83R probably damaging Het
Map2 A G 1: 66,410,637 E173G probably damaging Het
Med29 T A 7: 28,386,927 D152V possibly damaging Het
Megf8 A G 7: 25,363,515 D2432G probably damaging Het
Mrpl38 G A 11: 116,135,152 probably benign Het
Myh7 A G 14: 54,988,321 I521T possibly damaging Het
Mylk G T 16: 34,922,435 V1106L probably benign Het
Myo15b A T 11: 115,861,935 D753V possibly damaging Het
Myo1g T C 11: 6,516,785 probably null Het
Myrfl A G 10: 116,777,342 probably null Het
Naip5 A G 13: 100,223,414 V438A possibly damaging Het
Nav3 A G 10: 109,764,935 V1277A probably benign Het
Nek10 T A 14: 14,842,841 V182E possibly damaging Het
Ngly1 T C 14: 16,281,809 V355A probably benign Het
Nol6 T C 4: 41,118,944 E683G possibly damaging Het
Obsl1 A T 1: 75,503,441 V487E probably damaging Het
Oc90 T A 15: 65,881,505 R322W possibly damaging Het
Olfr1313 A G 2: 112,071,752 V277A possibly damaging Het
Olfr357 C A 2: 36,997,503 A231D probably benign Het
Olfr677 A T 7: 105,056,276 H10L possibly damaging Het
Olfr878 A G 9: 37,918,921 E93G possibly damaging Het
Osbp2 T C 11: 3,712,160 H231R probably damaging Het
Pdzph1 T C 17: 58,974,546 H247R probably damaging Het
Pidd1 T C 7: 141,442,249 N209S probably damaging Het
Pknox1 C T 17: 31,603,312 A351V probably damaging Het
Plxnd1 C A 6: 115,958,615 V1737F probably damaging Het
Prkdc A T 16: 15,702,112 K1138M probably damaging Het
Rad54l2 T C 9: 106,754,025 D21G possibly damaging Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Scgb2b6 T C 7: 31,619,483 noncoding transcript Het
Sdc1 A G 12: 8,790,541 E106G possibly damaging Het
Slc10a5 C A 3: 10,335,299 Q100H probably damaging Het
Slc10a5 T G 3: 10,335,300 Q100P probably damaging Het
Slc5a9 A T 4: 111,890,937 L226Q possibly damaging Het
Slfn1 T C 11: 83,121,649 V197A probably benign Het
Spire1 T C 18: 67,512,865 M244V probably benign Het
St3gal3 C T 4: 117,960,035 V141I probably benign Het
St6galnac4 G T 2: 32,587,160 probably benign Het
Svep1 T C 4: 58,097,323 K1407E possibly damaging Het
Tbc1d32 A G 10: 56,224,649 C78R probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmeff1 A T 4: 48,636,869 Y189F possibly damaging Het
Tmem131l C T 3: 83,899,212 A1433T probably benign Het
Tnfrsf8 T C 4: 145,303,122 Y36C probably damaging Het
Trp53i11 G T 2: 93,199,900 R184L probably damaging Het
Trpv1 A T 11: 73,251,284 M214L possibly damaging Het
Tsnax T A 8: 125,028,794 S132T probably benign Het
Ttc28 T C 5: 111,277,043 L1547P probably damaging Het
Ttc3 A G 16: 94,439,241 probably null Het
Tubal3 T A 13: 3,933,514 D431E probably damaging Het
Ugt2b36 A T 5: 87,092,442 probably null Het
Vmn1r23 A T 6: 57,926,205 I196K probably benign Het
Vmn1r55 A C 7: 5,146,587 L279R probably damaging Het
Vmn1r55 G T 7: 5,146,588 L279M probably damaging Het
Vmn2r89 G A 14: 51,457,485 G474E probably damaging Het
Vps26b T C 9: 27,015,215 K163E probably damaging Het
Zfp142 A G 1: 74,570,272 F1352L probably damaging Het
Zfp422 C T 6: 116,626,883 E52K possibly damaging Het
Zfp423 T A 8: 87,781,710 probably null Het
Zfp493 T C 13: 67,786,617 F230L probably damaging Het
Zfp760 T C 17: 21,722,407 C188R probably benign Het
Zfyve28 G T 5: 34,217,845 T275K probably damaging Het
Znhit3 T C 11: 84,916,329 N5D probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9297443 missense probably benign 0.24
IGL00481:Abca13 APN 11 9290969 missense probably damaging 0.99
IGL00707:Abca13 APN 11 9291586 missense probably damaging 0.99
IGL00755:Abca13 APN 11 9542102 missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9290870 missense probably damaging 1.00
IGL00802:Abca13 APN 11 9297717 missense probably damaging 0.96
IGL00807:Abca13 APN 11 9378285 missense probably benign 0.10
IGL00977:Abca13 APN 11 9399284 missense probably damaging 1.00
IGL01064:Abca13 APN 11 9483855 missense probably benign 0.01
IGL01100:Abca13 APN 11 9274673 splice site probably null
IGL01290:Abca13 APN 11 9256232 missense probably damaging 1.00
IGL01299:Abca13 APN 11 9298743 missense probably benign 0.22
IGL01302:Abca13 APN 11 9399470 splice site probably benign
IGL01307:Abca13 APN 11 9297159 missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9292076 missense probably benign 0.05
IGL01351:Abca13 APN 11 9267565 missense probably benign 0.28
IGL01446:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01453:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01461:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01476:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01506:Abca13 APN 11 9297447 missense probably benign 0.36
IGL01527:Abca13 APN 11 9290788 missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9309020 missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9293527 missense probably benign 0.00
IGL01679:Abca13 APN 11 9298071 missense probably benign 0.07
IGL01731:Abca13 APN 11 9249749 splice site probably benign
IGL01762:Abca13 APN 11 9315423 missense probably benign 0.18
IGL01781:Abca13 APN 11 9399280 missense probably damaging 1.00
IGL01802:Abca13 APN 11 9292438 missense probably benign 0.00
IGL01809:Abca13 APN 11 9290339 missense probably damaging 0.96
IGL01906:Abca13 APN 11 9216225 missense probably damaging 1.00
IGL01928:Abca13 APN 11 9683342 missense probably benign 0.13
IGL01940:Abca13 APN 11 9567661 splice site probably benign
IGL01993:Abca13 APN 11 9258452 unclassified probably benign
IGL02039:Abca13 APN 11 9297193 nonsense probably null
IGL02159:Abca13 APN 11 9314545 missense probably benign 0.00
IGL02202:Abca13 APN 11 9288529 missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9290626 missense probably benign 0.00
IGL02332:Abca13 APN 11 9291482 missense probably damaging 0.98
IGL02380:Abca13 APN 11 9291599 missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9297527 missense probably benign 0.00
IGL02505:Abca13 APN 11 9581498 missense probably damaging 1.00
IGL02507:Abca13 APN 11 9399388 missense probably damaging 1.00
IGL02558:Abca13 APN 11 9399387 missense probably damaging 1.00
IGL02581:Abca13 APN 11 9399132 splice site probably benign
IGL02586:Abca13 APN 11 9293983 missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9431898 missense probably damaging 1.00
IGL02747:Abca13 APN 11 9373282 nonsense probably null
IGL02893:Abca13 APN 11 9290543 missense probably damaging 0.96
IGL02930:Abca13 APN 11 9378226 missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9378291 missense probably damaging 0.99
IGL02983:Abca13 APN 11 9290663 missense probably benign 0.40
IGL02999:Abca13 APN 11 9581757 splice site probably benign
IGL03100:Abca13 APN 11 9258527 missense probably benign 0.25
IGL03114:Abca13 APN 11 9528999 missense probably benign 0.06
IGL03230:Abca13 APN 11 9294313 missense probably benign 0.02
IGL03329:Abca13 APN 11 9298047 missense probably benign 0.08
IGL03380:Abca13 APN 11 9298574 missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9451515 missense probably damaging 1.00
R0017:Abca13 UTSW 11 9292775 missense probably damaging 0.99
R0079:Abca13 UTSW 11 9293493 missense probably benign 0.00
R0089:Abca13 UTSW 11 9292886 missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0113:Abca13 UTSW 11 9292114 missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0152:Abca13 UTSW 11 9581724 missense probably damaging 0.98
R0255:Abca13 UTSW 11 9581545 missense probably damaging 1.00
R0277:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0278:Abca13 UTSW 11 9378215 missense probably damaging 1.00
R0294:Abca13 UTSW 11 9269122 splice site probably null
R0299:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0310:Abca13 UTSW 11 9293810 missense probably benign 0.36
R0317:Abca13 UTSW 11 9293459 missense probably damaging 1.00
R0323:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0324:Abca13 UTSW 11 9297669 missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9399430 missense probably damaging 0.97
R0336:Abca13 UTSW 11 9298481 missense probably benign 0.04
R0346:Abca13 UTSW 11 9566278 missense probably damaging 0.99
R0380:Abca13 UTSW 11 9588500 splice site probably null
R0382:Abca13 UTSW 11 9636650 splice site probably benign
R0482:Abca13 UTSW 11 9328207 missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9331687 missense probably benign 0.07
R0491:Abca13 UTSW 11 9298235 missense probably benign 0.02
R0496:Abca13 UTSW 11 9291701 missense probably benign 0.01
R0505:Abca13 UTSW 11 9291058 missense probably benign 0.00
R0511:Abca13 UTSW 11 9294559 missense probably benign
R0525:Abca13 UTSW 11 9293371 missense probably damaging 1.00
R0538:Abca13 UTSW 11 9267622 critical splice donor site probably null
R0615:Abca13 UTSW 11 9256197 missense probably damaging 0.96
R0634:Abca13 UTSW 11 9314491 missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9588508 splice site probably benign
R0848:Abca13 UTSW 11 9682011 nonsense probably null
R0883:Abca13 UTSW 11 9291238 nonsense probably null
R0892:Abca13 UTSW 11 9298305 missense probably benign 0.00
R0904:Abca13 UTSW 11 9298740 missense probably benign 0.22
R0968:Abca13 UTSW 11 9298016 missense probably benign 0.00
R1187:Abca13 UTSW 11 9528981 missense probably benign 0.00
R1299:Abca13 UTSW 11 9294821 missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9291836 missense probably benign
R1387:Abca13 UTSW 11 9682085 nonsense probably null
R1436:Abca13 UTSW 11 9292646 missense probably damaging 0.99
R1449:Abca13 UTSW 11 9298580 missense probably damaging 1.00
R1450:Abca13 UTSW 11 9430531 splice site probably benign
R1462:Abca13 UTSW 11 9483924 splice site probably benign
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1466:Abca13 UTSW 11 9570536 splice site probably benign
R1494:Abca13 UTSW 11 9466429 nonsense probably null
R1559:Abca13 UTSW 11 9399180 missense probably null 1.00
R1564:Abca13 UTSW 11 9434316 nonsense probably null
R1698:Abca13 UTSW 11 9314507 missense probably benign 0.13
R1728:Abca13 UTSW 11 9249680 missense probably benign 0.02
R1734:Abca13 UTSW 11 9585460 missense probably benign 0.03
R1781:Abca13 UTSW 11 9269194 missense probably damaging 1.00
R1782:Abca13 UTSW 11 9297971 missense probably benign 0.36
R1807:Abca13 UTSW 11 9291755 missense probably damaging 0.98
R1830:Abca13 UTSW 11 9290350 missense probably benign 0.04
R1869:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1870:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1871:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1903:Abca13 UTSW 11 9466411 missense probably benign 0.13
R1916:Abca13 UTSW 11 9534456 missense probably damaging 1.00
R1936:Abca13 UTSW 11 9293595 missense probably benign 0.13
R1976:Abca13 UTSW 11 9397815 missense probably damaging 1.00
R2001:Abca13 UTSW 11 9273967 missense probably benign 0.01
R2007:Abca13 UTSW 11 9191987 missense probably benign 0.19
R2016:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2017:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2034:Abca13 UTSW 11 9292628 missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9328098 missense probably benign 0.04
R2075:Abca13 UTSW 11 9522382 missense probably damaging 1.00
R2118:Abca13 UTSW 11 9309013 splice site probably benign
R2120:Abca13 UTSW 11 9309013 splice site probably benign
R2124:Abca13 UTSW 11 9309013 splice site probably benign
R2148:Abca13 UTSW 11 9615764 missense probably damaging 1.00
R2149:Abca13 UTSW 11 9267508 missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9577170 missense probably damaging 0.97
R2167:Abca13 UTSW 11 9288532 missense probably benign 0.19
R2261:Abca13 UTSW 11 9292288 missense probably benign
R2263:Abca13 UTSW 11 9274702 missense probably benign 0.04
R2281:Abca13 UTSW 11 9328136 missense probably damaging 0.98
R2340:Abca13 UTSW 11 9399165 missense probably damaging 0.99
R2357:Abca13 UTSW 11 9297336 missense probably damaging 1.00
R2370:Abca13 UTSW 11 9256185 missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9267450 splice site probably benign
R2393:Abca13 UTSW 11 9275057 nonsense probably null
R2432:Abca13 UTSW 11 9451333 splice site probably benign
R2446:Abca13 UTSW 11 9275101 missense probably benign
R2568:Abca13 UTSW 11 9333310 missense probably benign 0.40
R2847:Abca13 UTSW 11 9294584 missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2861:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2862:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2877:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9316119 splice site probably benign
R3789:Abca13 UTSW 11 9510668 missense probably damaging 0.97
R3933:Abca13 UTSW 11 9354856 missense probably damaging 1.00
R3981:Abca13 UTSW 11 9532407 missense probably benign
R4002:Abca13 UTSW 11 9585415 missense probably benign 0.00
R4010:Abca13 UTSW 11 9622013 splice site probably benign
R4011:Abca13 UTSW 11 9622013 splice site probably benign
R4127:Abca13 UTSW 11 9191973 missense probably benign 0.00
R4214:Abca13 UTSW 11 9293877 missense probably damaging 0.96
R4236:Abca13 UTSW 11 9256205 missense probably damaging 1.00
R4237:Abca13 UTSW 11 9434188 missense probably benign 0.01
R4359:Abca13 UTSW 11 9297629 missense probably benign 0.02
R4378:Abca13 UTSW 11 9293644 missense probably benign 0.00
R4389:Abca13 UTSW 11 9297878 missense probably damaging 0.98
R4392:Abca13 UTSW 11 9309034 missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9309130 missense probably damaging 1.00
R4684:Abca13 UTSW 11 9434193 nonsense probably null
R4691:Abca13 UTSW 11 9434195 missense probably damaging 1.00
R4701:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9276990 missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9277973 critical splice donor site probably null
R4772:Abca13 UTSW 11 9315339 splice site probably null
R4782:Abca13 UTSW 11 9328096 missense probably damaging 0.96
R4801:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9290421 missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9542077 nonsense probably null
R4851:Abca13 UTSW 11 9483890 missense probably benign 0.02
R4857:Abca13 UTSW 11 9294143 missense probably benign 0.22
R4869:Abca13 UTSW 11 9315434 splice site probably null
R4982:Abca13 UTSW 11 9292348 missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9297678 missense probably damaging 0.99
R5044:Abca13 UTSW 11 9373323 missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9258535 missense probably damaging 1.00
R5155:Abca13 UTSW 11 9532447 missense probably damaging 0.98
R5173:Abca13 UTSW 11 9682032 frame shift probably null
R5180:Abca13 UTSW 11 9466510 missense probably benign 0.01
R5244:Abca13 UTSW 11 9275081 missense probably benign 0.28
R5257:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9431861 missense probably damaging 1.00
R5363:Abca13 UTSW 11 9277035 missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9628629 missense probably damaging 1.00
R5419:Abca13 UTSW 11 9193533 critical splice donor site probably null
R5426:Abca13 UTSW 11 9290722 missense probably damaging 1.00
R5468:Abca13 UTSW 11 9294062 missense probably damaging 1.00
R5477:Abca13 UTSW 11 9301298 missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9291545 missense probably benign 0.00
R5553:Abca13 UTSW 11 9328158 missense probably damaging 1.00
R5556:Abca13 UTSW 11 9258546 missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9294615 nonsense probably null
R5582:Abca13 UTSW 11 9636639 splice site probably null
R5604:Abca13 UTSW 11 9566279 missense probably damaging 0.97
R5609:Abca13 UTSW 11 9403874 missense probably benign 0.01
R5617:Abca13 UTSW 11 9277891 missense probably benign 0.00
R5693:Abca13 UTSW 11 9316233 missense probably benign 0.29
R5707:Abca13 UTSW 11 9510620 missense probably damaging 1.00
R5725:Abca13 UTSW 11 9577181 missense probably benign 0.00
R5728:Abca13 UTSW 11 9570576 missense probably damaging 1.00
R5738:Abca13 UTSW 11 9621917 missense probably damaging 1.00
R5758:Abca13 UTSW 11 9314536 missense probably damaging 0.97
R5762:Abca13 UTSW 11 9581665 missense probably damaging 1.00
R5771:Abca13 UTSW 11 9291411 missense probably damaging 1.00
R5809:Abca13 UTSW 11 9293692 missense probably damaging 1.00
R5826:Abca13 UTSW 11 9682056 missense probably damaging 0.99
R5831:Abca13 UTSW 11 9567777 nonsense probably null
R5834:Abca13 UTSW 11 9277974 critical splice donor site probably null
R5902:Abca13 UTSW 11 9297177 missense probably damaging 1.00
R5933:Abca13 UTSW 11 9249658 missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9293398 missense probably benign 0.04
R5969:Abca13 UTSW 11 9292214 nonsense probably null
R5985:Abca13 UTSW 11 9291628 missense probably benign 0.02
R5998:Abca13 UTSW 11 9567708 missense probably damaging 0.97
R6021:Abca13 UTSW 11 9290465 nonsense probably null
R6022:Abca13 UTSW 11 9290759 missense probably damaging 1.00
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9397812 missense probably damaging 1.00
R6153:Abca13 UTSW 11 9301259 critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9309047 missense probably damaging 1.00
R6187:Abca13 UTSW 11 9309085 missense probably damaging 1.00
R6247:Abca13 UTSW 11 9403874 missense probably benign 0.01
R6329:Abca13 UTSW 11 9277937 missense probably damaging 1.00
R6352:Abca13 UTSW 11 9309139 splice site probably null
R6367:Abca13 UTSW 11 9216248 missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9298778 missense probably benign 0.01
R6424:Abca13 UTSW 11 9510542 missense probably benign
R6456:Abca13 UTSW 11 9290474 missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9298661 missense probably benign 0.00
R6547:Abca13 UTSW 11 9274757 missense probably benign 0.04
R6594:Abca13 UTSW 11 9294632 missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9378384 missense probably damaging 1.00
R6614:Abca13 UTSW 11 9294371 missense probably benign 0.04
R6736:Abca13 UTSW 11 9465058 missense probably damaging 1.00
R6742:Abca13 UTSW 11 9328168 missense probably damaging 1.00
R6791:Abca13 UTSW 11 9378504 missense probably damaging 1.00
R6834:Abca13 UTSW 11 9275110 missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9298568 missense probably damaging 0.96
R6955:Abca13 UTSW 11 9294307 missense probably benign 0.28
X0013:Abca13 UTSW 11 9273899 missense probably benign 0.02
X0057:Abca13 UTSW 11 9294744 missense probably damaging 0.96
X0066:Abca13 UTSW 11 9267565 missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9294687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAAGCATCATCAAGGAGCTG -3'
(R):5'- ACTCATTCCATGGACAAATGGG -3'

Sequencing Primer
(F):5'- CATCATCAAGGAGCTGAAAGAAAC -3'
(R):5'- CCATGGACAAATGGGTCTTTTC -3'
Posted On2015-10-21