Incidental Mutation 'R0402:Ralgapa2'
ID35599
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0402 (G1)
Quality Score182
Status Validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 146434809 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 504 (V504M)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109982
Predicted Effect possibly damaging
Transcript: ENSMUST00000109986
AA Change: V504M

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: V504M

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131824
AA Change: V504M

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: V504M

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135974
Predicted Effect unknown
Transcript: ENSMUST00000149499
AA Change: V174M
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: V174M

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228797
AA Change: V504M

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1330 A T 4: 118,893,229 I49F possibly damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5439:Ralgapa2 UTSW 2 146342510 missense probably benign 0.08
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
R7167:Ralgapa2 UTSW 2 146348454 missense probably benign
R7186:Ralgapa2 UTSW 2 146388486 splice site probably null
R7252:Ralgapa2 UTSW 2 146342751 critical splice acceptor site probably null
R7266:Ralgapa2 UTSW 2 146334568 missense probably damaging 1.00
R7371:Ralgapa2 UTSW 2 146347126 missense probably benign 0.05
R7432:Ralgapa2 UTSW 2 146434856 missense probably benign 0.41
R7470:Ralgapa2 UTSW 2 146424667 missense probably damaging 1.00
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACCCCTCCAAGTATCTGTGTCAAGG -3'
(R):5'- GCTGAGCATGGAAACGTAGGCTTC -3'

Sequencing Primer
(F):5'- ATCTGTGTCAAGGTCACAGGC -3'
(R):5'- AAACGTAGGCTTCTTCCTACTTGG -3'
Posted On2013-05-09