Incidental Mutation 'R4701:Fmn1'
ID355997
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 041949-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R4701 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113584071 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 895 (Y895F)
Ref Sequence ENSEMBL: ENSMUSP00000080093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
PDB Structure
FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081349
AA Change: Y895F

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: Y895F

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099576
AA Change: Y1121F

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: Y1121F

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102547
AA Change: Y1121F

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: Y1121F

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161731
AA Change: Y1023F

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: Y1023F

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185668
AA Change: Y970F
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,411,160 I196V probably benign Het
Aass T A 6: 23,075,856 K761* probably null Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abhd16a T C 17: 35,096,606 probably null Het
Acad11 C T 9: 104,095,565 Q486* probably null Het
Actl9 T C 17: 33,433,935 L323P probably benign Het
Adam12 T A 7: 133,916,462 I650F possibly damaging Het
Adgre4 A T 17: 55,784,971 D77V probably damaging Het
Ankrd26 A G 6: 118,506,485 F1586S possibly damaging Het
Anpep T C 7: 79,839,465 T320A probably benign Het
Arl15 T A 13: 113,967,725 C133S probably benign Het
Ascc3 A G 10: 50,720,664 N1230S possibly damaging Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
Atp8b4 A G 2: 126,414,293 F249L probably damaging Het
AU021092 G T 16: 5,212,193 N319K probably benign Het
Bbs4 A G 9: 59,323,519 V440A probably benign Het
Bpifb4 G T 2: 153,950,385 G450C probably damaging Het
Cadm1 G A 9: 47,818,822 probably benign Het
Ccser2 G A 14: 36,938,697 L500F probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Cdkl4 A T 17: 80,543,652 V207E probably damaging Het
Cfap65 T C 1: 74,918,908 D947G probably damaging Het
Cntn6 T C 6: 104,804,360 V397A probably benign Het
Cpox T A 16: 58,677,969 Y388* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dda1 T A 8: 71,473,810 Y58N probably damaging Het
Dennd4a C T 9: 64,897,357 T1326I possibly damaging Het
Eps8l2 A T 7: 141,357,260 I338F probably damaging Het
Fbxo42 A G 4: 141,199,809 T467A probably benign Het
Flt4 T C 11: 49,626,808 F319S possibly damaging Het
Gm6887 C A 7: 42,465,093 noncoding transcript Het
Grid2 A G 6: 64,665,915 D887G probably benign Het
Grm6 C T 11: 50,863,010 P714S probably damaging Het
Gsto2 A G 19: 47,884,656 I157V probably benign Het
Il15ra A G 2: 11,718,345 probably null Het
Impg1 A G 9: 80,314,400 F713L probably benign Het
Jag1 T A 2: 137,094,456 T373S probably benign Het
Kcnh3 T A 15: 99,241,945 L904Q probably benign Het
Kctd19 C A 8: 105,390,429 G356V possibly damaging Het
Kdm5b T A 1: 134,606,012 probably benign Het
Kif1a T C 1: 93,078,835 I37V probably damaging Het
Lama5 G A 2: 180,191,696 R1508C probably damaging Het
Lamb1 T A 12: 31,266,848 C65* probably null Het
Lingo1 A G 9: 56,620,258 F349S probably damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Med17 A T 9: 15,270,360 H31Q probably damaging Het
Med23 A T 10: 24,893,648 L476F probably damaging Het
Mgst1 A T 6: 138,150,838 D66V probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Muc4 A T 16: 32,755,846 probably benign Het
Myo18a C T 11: 77,817,665 T30M probably damaging Het
Ncapg2 G T 12: 116,440,618 R903L probably benign Het
Nme1 A G 11: 93,965,908 I9T probably damaging Het
Nmt2 T A 2: 3,322,641 I357N probably benign Het
Nphp4 T C 4: 152,496,659 F100S probably damaging Het
Oca2 C A 7: 56,255,002 T72K probably benign Het
Olfr1411 C A 1: 92,597,438 D306E probably benign Het
Olfr625-ps1 G A 7: 103,683,062 V105M probably damaging Het
Olfr676 A T 7: 105,035,591 D131V probably damaging Het
Olfr677 A T 7: 105,056,879 D211V probably damaging Het
Olfr871 T C 9: 20,212,625 I92T probably damaging Het
Plce1 A T 19: 38,725,007 T1240S probably benign Het
Plch1 A T 3: 63,699,496 probably null Het
Plxna4 T C 6: 32,516,688 D331G probably damaging Het
Ppp1r3a T C 6: 14,718,993 T641A probably benign Het
Rab32 A G 10: 10,550,854 L116P probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Rorc G C 3: 94,391,710 E391Q probably null Het
Saa4 A T 7: 46,731,627 F24I possibly damaging Het
Sall1 T A 8: 89,031,160 K772M probably damaging Het
Sdk1 T G 5: 142,185,231 L1950V probably damaging Het
Sil1 T C 18: 35,266,896 E352G probably benign Het
Slc26a3 C T 12: 31,447,774 P59L probably damaging Het
Smco2 T C 6: 146,861,942 probably benign Het
Sppl3 A G 5: 115,103,313 probably null Het
St6gal2 T A 17: 55,496,344 V360D probably damaging Het
Stard9 G A 2: 120,705,713 R345Q possibly damaging Het
Susd4 T A 1: 182,892,061 Y414N probably damaging Het
Tenm4 T C 7: 96,895,349 Y2191H probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmem132c T A 5: 127,564,496 probably benign Het
Tnn A T 1: 160,147,768 S30T possibly damaging Het
Trpd52l3 G T 19: 30,004,495 V217F probably damaging Het
Trpm1 G T 7: 64,243,500 L1033F probably damaging Het
Tulp2 A G 7: 45,517,924 E182G probably damaging Het
Ubr4 A G 4: 139,471,336 K4490R possibly damaging Het
Usp17la A T 7: 104,860,649 R154* probably null Het
Vmn2r17 T G 5: 109,427,983 M240R probably damaging Het
Vmn2r22 T A 6: 123,650,469 N56I probably benign Het
Wdr66 A G 5: 123,322,613 K1213E probably benign Het
Zdhhc21 A T 4: 82,820,334 I206N possibly damaging Het
Zfp148 T A 16: 33,456,908 D122E probably benign Het
Zfp804a A T 2: 82,256,582 S252C probably damaging Het
Zgrf1 C T 3: 127,598,704 T1291I probably benign Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACCATTTGCTTTAGCTGGTAAATGC -3'
(R):5'- ACGCTGTTGTAACTCAGCC -3'

Sequencing Primer
(F):5'- GCTTTAGCTGGTAAATGCCAAGC -3'
(R):5'- GTTGTAACTCAGCCCTCTACG -3'
Posted On2015-10-21