Incidental Mutation 'R4701:Eps8l2'
ID356037
Institutional Source Beutler Lab
Gene Symbol Eps8l2
Ensembl Gene ENSMUSG00000025504
Gene NameEPS8-like 2
Synonyms
MMRRC Submission 041949-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4701 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141338880-141363020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141357260 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 338 (I338F)
Ref Sequence ENSEMBL: ENSMUSP00000026577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026577] [ENSMUST00000143633]
Predicted Effect probably damaging
Transcript: ENSMUST00000026577
AA Change: I338F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026577
Gene: ENSMUSG00000025504
AA Change: I338F

DomainStartEndE-ValueType
Pfam:PTB 51 181 6.6e-50 PFAM
Pfam:PID 52 175 5.9e-9 PFAM
low complexity region 196 209 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
SH3 498 553 2.11e-15 SMART
PDB:1WWU|A 614 700 2e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140025
Predicted Effect probably benign
Transcript: ENSMUST00000143633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210158
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null mutation display late onset progressive hearing loss and gradual deterioration of cochlear hair cell stereocilliary bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,411,160 I196V probably benign Het
Aass T A 6: 23,075,856 K761* probably null Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abhd16a T C 17: 35,096,606 probably null Het
Acad11 C T 9: 104,095,565 Q486* probably null Het
Actl9 T C 17: 33,433,935 L323P probably benign Het
Adam12 T A 7: 133,916,462 I650F possibly damaging Het
Adgre4 A T 17: 55,784,971 D77V probably damaging Het
Ankrd26 A G 6: 118,506,485 F1586S possibly damaging Het
Anpep T C 7: 79,839,465 T320A probably benign Het
Arl15 T A 13: 113,967,725 C133S probably benign Het
Ascc3 A G 10: 50,720,664 N1230S possibly damaging Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
Atp8b4 A G 2: 126,414,293 F249L probably damaging Het
AU021092 G T 16: 5,212,193 N319K probably benign Het
Bbs4 A G 9: 59,323,519 V440A probably benign Het
Bpifb4 G T 2: 153,950,385 G450C probably damaging Het
Cadm1 G A 9: 47,818,822 probably benign Het
Ccser2 G A 14: 36,938,697 L500F probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Cdkl4 A T 17: 80,543,652 V207E probably damaging Het
Cfap65 T C 1: 74,918,908 D947G probably damaging Het
Cntn6 T C 6: 104,804,360 V397A probably benign Het
Cpox T A 16: 58,677,969 Y388* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dda1 T A 8: 71,473,810 Y58N probably damaging Het
Dennd4a C T 9: 64,897,357 T1326I possibly damaging Het
Fbxo42 A G 4: 141,199,809 T467A probably benign Het
Flt4 T C 11: 49,626,808 F319S possibly damaging Het
Fmn1 A T 2: 113,584,071 Y895F possibly damaging Het
Gm6887 C A 7: 42,465,093 noncoding transcript Het
Grid2 A G 6: 64,665,915 D887G probably benign Het
Grm6 C T 11: 50,863,010 P714S probably damaging Het
Gsto2 A G 19: 47,884,656 I157V probably benign Het
Il15ra A G 2: 11,718,345 probably null Het
Impg1 A G 9: 80,314,400 F713L probably benign Het
Jag1 T A 2: 137,094,456 T373S probably benign Het
Kcnh3 T A 15: 99,241,945 L904Q probably benign Het
Kctd19 C A 8: 105,390,429 G356V possibly damaging Het
Kdm5b T A 1: 134,606,012 probably benign Het
Kif1a T C 1: 93,078,835 I37V probably damaging Het
Lama5 G A 2: 180,191,696 R1508C probably damaging Het
Lamb1 T A 12: 31,266,848 C65* probably null Het
Lingo1 A G 9: 56,620,258 F349S probably damaging Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Med17 A T 9: 15,270,360 H31Q probably damaging Het
Med23 A T 10: 24,893,648 L476F probably damaging Het
Mgst1 A T 6: 138,150,838 D66V probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Muc4 A T 16: 32,755,846 probably benign Het
Myo18a C T 11: 77,817,665 T30M probably damaging Het
Ncapg2 G T 12: 116,440,618 R903L probably benign Het
Nme1 A G 11: 93,965,908 I9T probably damaging Het
Nmt2 T A 2: 3,322,641 I357N probably benign Het
Nphp4 T C 4: 152,496,659 F100S probably damaging Het
Oca2 C A 7: 56,255,002 T72K probably benign Het
Olfr1411 C A 1: 92,597,438 D306E probably benign Het
Olfr625-ps1 G A 7: 103,683,062 V105M probably damaging Het
Olfr676 A T 7: 105,035,591 D131V probably damaging Het
Olfr677 A T 7: 105,056,879 D211V probably damaging Het
Olfr871 T C 9: 20,212,625 I92T probably damaging Het
Plce1 A T 19: 38,725,007 T1240S probably benign Het
Plch1 A T 3: 63,699,496 probably null Het
Plxna4 T C 6: 32,516,688 D331G probably damaging Het
Ppp1r3a T C 6: 14,718,993 T641A probably benign Het
Rab32 A G 10: 10,550,854 L116P probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Rorc G C 3: 94,391,710 E391Q probably null Het
Saa4 A T 7: 46,731,627 F24I possibly damaging Het
Sall1 T A 8: 89,031,160 K772M probably damaging Het
Sdk1 T G 5: 142,185,231 L1950V probably damaging Het
Sil1 T C 18: 35,266,896 E352G probably benign Het
Slc26a3 C T 12: 31,447,774 P59L probably damaging Het
Smco2 T C 6: 146,861,942 probably benign Het
Sppl3 A G 5: 115,103,313 probably null Het
St6gal2 T A 17: 55,496,344 V360D probably damaging Het
Stard9 G A 2: 120,705,713 R345Q possibly damaging Het
Susd4 T A 1: 182,892,061 Y414N probably damaging Het
Tenm4 T C 7: 96,895,349 Y2191H probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmem132c T A 5: 127,564,496 probably benign Het
Tnn A T 1: 160,147,768 S30T possibly damaging Het
Trpd52l3 G T 19: 30,004,495 V217F probably damaging Het
Trpm1 G T 7: 64,243,500 L1033F probably damaging Het
Tulp2 A G 7: 45,517,924 E182G probably damaging Het
Ubr4 A G 4: 139,471,336 K4490R possibly damaging Het
Usp17la A T 7: 104,860,649 R154* probably null Het
Vmn2r17 T G 5: 109,427,983 M240R probably damaging Het
Vmn2r22 T A 6: 123,650,469 N56I probably benign Het
Wdr66 A G 5: 123,322,613 K1213E probably benign Het
Zdhhc21 A T 4: 82,820,334 I206N possibly damaging Het
Zfp148 T A 16: 33,456,908 D122E probably benign Het
Zfp804a A T 2: 82,256,582 S252C probably damaging Het
Zgrf1 C T 3: 127,598,704 T1291I probably benign Het
Other mutations in Eps8l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Eps8l2 APN 7 141357663 missense probably benign 0.06
IGL01444:Eps8l2 APN 7 141361375 splice site probably benign
IGL01467:Eps8l2 APN 7 141361601 missense probably damaging 1.00
IGL01803:Eps8l2 APN 7 141358230 missense probably benign
IGL02598:Eps8l2 APN 7 141354936 splice site probably benign
IGL02823:Eps8l2 APN 7 141342075 missense probably damaging 1.00
IGL03061:Eps8l2 APN 7 141357235 unclassified probably benign
IGL03112:Eps8l2 APN 7 141361736 missense probably damaging 1.00
IGL03251:Eps8l2 APN 7 141342962 missense probably damaging 1.00
R0057:Eps8l2 UTSW 7 141342971 missense probably benign 0.08
R0133:Eps8l2 UTSW 7 141362207 missense unknown
R0361:Eps8l2 UTSW 7 141356199 missense probably benign 0.05
R0409:Eps8l2 UTSW 7 141342980 missense probably damaging 1.00
R0611:Eps8l2 UTSW 7 141355733 missense probably damaging 1.00
R1487:Eps8l2 UTSW 7 141361618 missense probably benign
R1679:Eps8l2 UTSW 7 141361057 missense probably damaging 1.00
R1914:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1915:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1918:Eps8l2 UTSW 7 141361724 missense probably damaging 0.99
R2098:Eps8l2 UTSW 7 141355792 unclassified probably null
R2170:Eps8l2 UTSW 7 141342071 missense probably benign 0.02
R3429:Eps8l2 UTSW 7 141357919 critical splice donor site probably null
R3734:Eps8l2 UTSW 7 141357821 missense probably damaging 1.00
R4296:Eps8l2 UTSW 7 141358262 nonsense probably null
R4758:Eps8l2 UTSW 7 141360373 missense probably damaging 0.98
R5564:Eps8l2 UTSW 7 141356621 missense possibly damaging 0.94
R5567:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5570:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5735:Eps8l2 UTSW 7 141360377 missense probably damaging 1.00
R5893:Eps8l2 UTSW 7 141357624 missense probably damaging 1.00
R5905:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R5927:Eps8l2 UTSW 7 141356346 missense probably benign
R6028:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R6248:Eps8l2 UTSW 7 141342102 missense probably damaging 0.99
R6631:Eps8l2 UTSW 7 141356202 missense probably damaging 1.00
R7152:Eps8l2 UTSW 7 141355765 missense possibly damaging 0.95
R7231:Eps8l2 UTSW 7 141360392 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTCCACGTTTTGCCAGAG -3'
(R):5'- GAACCCAGACAGAGCTTGAG -3'

Sequencing Primer
(F):5'- TGCCAGAGGGTGTCCTTAC -3'
(R):5'- CCCAGACAGAGCTTGAGTATGC -3'
Posted On2015-10-21