Incidental Mutation 'R0402:Olfr1330'
ID35604
Institutional Source Beutler Lab
Gene Symbol Olfr1330
Ensembl Gene ENSMUSG00000073768
Gene Nameolfactory receptor 1330
SynonymsGA_x6K02T2QD9B-18644371-18643424, MOR259-8
MMRRC Submission 038607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0402 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118888597-118899597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118893229 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 49 (I49F)
Ref Sequence ENSEMBL: ENSMUSP00000101968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094830] [ENSMUST00000105035] [ENSMUST00000106361]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094830
AA Change: I49F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092425
Gene: ENSMUSG00000073768
AA Change: I49F

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 1.2e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 308 1.4e-6 PFAM
Pfam:7tm_1 44 293 1.6e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105035
AA Change: I49F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100652
Gene: ENSMUSG00000073768
AA Change: I49F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 307 6.4e-8 PFAM
Pfam:7tm_1 44 293 2.9e-31 PFAM
Pfam:7tm_4 142 286 6.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106361
AA Change: I49F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101968
Gene: ENSMUSG00000073768
AA Change: I49F

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.1e-56 PFAM
Pfam:7tm_1 43 292 3.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216386
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.0%
  • 10x: 94.5%
  • 20x: 88.7%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A T 10: 100,609,253 K165N probably damaging Het
Adam6b T A 12: 113,489,995 M144K probably damaging Het
Arhgap44 T C 11: 65,032,077 probably benign Het
Arl5c T A 11: 97,995,113 I21F probably damaging Het
Bglap2 C T 3: 88,378,245 G40D probably damaging Het
Bptf T C 11: 107,074,114 E1303G probably damaging Het
Calhm1 T C 19: 47,141,457 T209A probably damaging Het
Ccr8 A G 9: 120,094,910 probably null Het
Chkb C T 15: 89,429,407 R65Q probably benign Het
Col4a1 T C 8: 11,199,838 probably benign Het
Cryzl2 A G 1: 157,464,444 T98A probably benign Het
D430041D05Rik T C 2: 104,168,164 T1080A probably damaging Het
Dhx8 C A 11: 101,752,397 T765N probably damaging Het
Dicer1 T C 12: 104,731,064 D78G probably benign Het
Drd2 A G 9: 49,404,971 I344V probably benign Het
Edil3 A T 13: 89,199,451 probably benign Het
Fam71a T C 1: 191,164,440 D2G probably benign Het
Fam71f1 A G 6: 29,323,902 T209A probably benign Het
Fbxw19 C T 9: 109,484,425 G235D probably benign Het
Fzd1 T C 5: 4,755,702 K627E possibly damaging Het
Gm10638 A G 8: 86,746,200 probably benign Het
Gm14124 T A 2: 150,269,216 C609S possibly damaging Het
H6pd G T 4: 149,996,316 A24E probably damaging Het
Hectd2 G T 19: 36,601,529 probably null Het
Hps5 A G 7: 46,790,909 probably benign Het
Irx3 T C 8: 91,800,668 N136S possibly damaging Het
Kcmf1 T C 6: 72,849,585 M1V probably null Het
Klrb1 A T 6: 128,710,620 F104I probably benign Het
Lrfn5 T C 12: 61,840,017 M197T probably benign Het
Mpdz A C 4: 81,361,440 M51R possibly damaging Het
Mtbp G T 15: 55,569,070 E258* probably null Het
Mylk3 T A 8: 85,352,910 H373L probably damaging Het
Myrfl A G 10: 116,828,977 S383P probably damaging Het
Nt5c T C 11: 115,490,642 *195W probably null Het
Ocstamp A G 2: 165,396,264 V360A possibly damaging Het
Olfr1180 A T 2: 88,412,034 V208D probably damaging Het
Olfr122 T A 17: 37,772,393 C247S probably damaging Het
Olfr1277 A G 2: 111,269,863 F168S probably damaging Het
Olfr1431 A G 19: 12,209,589 T8A probably damaging Het
Otop2 T C 11: 115,326,408 probably benign Het
Pom121l2 A T 13: 21,988,479 probably benign Het
Pon2 T A 6: 5,272,410 K137* probably null Het
Ppip5k2 T A 1: 97,719,854 Q1049L probably benign Het
Ralgapa2 C T 2: 146,434,809 V504M probably damaging Het
Rph3a G A 5: 120,942,254 H654Y probably damaging Het
Sh2d1b1 T C 1: 170,279,773 probably benign Het
Slc15a2 G A 16: 36,775,598 T154I probably benign Het
Slc45a3 T C 1: 131,977,527 V96A possibly damaging Het
Slc7a4 A G 16: 17,575,633 S101P probably damaging Het
Smco2 T C 6: 146,871,135 probably benign Het
Spata2 A T 2: 167,483,660 V413E probably benign Het
Specc1l A G 10: 75,246,426 E552G probably damaging Het
Sstr5 C T 17: 25,492,034 V74M probably benign Het
Timm50 G A 7: 28,306,855 R274W probably damaging Het
Tll2 A G 19: 41,098,693 V573A possibly damaging Het
Tm7sf3 C A 6: 146,606,187 R459M possibly damaging Het
Txk A G 5: 72,731,762 probably null Het
Uroc1 A G 6: 90,347,302 D436G probably damaging Het
Vmn1r13 T A 6: 57,210,098 Y81N possibly damaging Het
Vmn2r19 A G 6: 123,336,182 E737G probably damaging Het
Wfs1 A G 5: 36,976,980 probably benign Het
Zfp1 G A 8: 111,670,243 E285K probably damaging Het
Zfp661 G A 2: 127,577,720 Q167* probably null Het
Zswim8 T C 14: 20,710,766 F36S probably damaging Het
Zw10 A G 9: 49,068,723 T385A probably benign Het
Other mutations in Olfr1330
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Olfr1330 APN 4 118893551 missense probably benign 0.00
IGL01642:Olfr1330 APN 4 118893461 missense probably damaging 1.00
R0418:Olfr1330 UTSW 4 118893251 missense possibly damaging 0.51
R0646:Olfr1330 UTSW 4 118893490 missense probably damaging 0.96
R1075:Olfr1330 UTSW 4 118893205 missense probably damaging 1.00
R1743:Olfr1330 UTSW 4 118893526 missense probably benign
R1950:Olfr1330 UTSW 4 118893340 missense probably benign 0.22
R2265:Olfr1330 UTSW 4 118893874 missense probably damaging 1.00
R2268:Olfr1330 UTSW 4 118893874 missense probably damaging 1.00
R2269:Olfr1330 UTSW 4 118893874 missense probably damaging 1.00
R4648:Olfr1330 UTSW 4 118893950 missense possibly damaging 0.84
R5635:Olfr1330 UTSW 4 118893635 missense probably benign 0.31
R6881:Olfr1330 UTSW 4 118893107 missense probably damaging 1.00
R7351:Olfr1330 UTSW 4 118893836 missense probably benign 0.05
R7412:Olfr1330 UTSW 4 118893130 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACAGCATCAGTACCTCACTTTTGGAC -3'
(R):5'- TGCACTCAGTTATACCCAGGGCAC -3'

Sequencing Primer
(F):5'- GCCTCTATTGTTACCATGTGTCAAG -3'
(R):5'- GTTATACCCAGGGCACTGAAAAC -3'
Posted On2013-05-09