Incidental Mutation 'R4702:0610037L13Rik'
List |< first << previous [record 53 of 386652] next >> last >|
ID356108
Institutional Source Beutler Lab
Gene Symbol 0610037L13Rik
Ensembl Gene ENSMUSG00000028608
Gene NameRIKEN cDNA 0610037L13 gene
Synonyms
MMRRC Submission 041950-MU
Accession Numbers
Stock #R4702 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location107889813-107899384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107893316 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 48 (Q48R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156888]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156888
AA Change: Q48R
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,329,403 T1316A probably benign Het
4921509C19Rik T C 2: 151,472,589 T390A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Adra1a T C 14: 66,637,559 unknown Het
Aff1 T C 5: 103,811,069 Y343H probably damaging Het
Antxr2 C T 5: 97,949,169 probably null Het
Ap1m2 A G 9: 21,298,295 F362L probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Armc3 A G 2: 19,309,981 N822S probably damaging Het
Atr A C 9: 95,920,355 T1767P possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F probably benign Het
BC089491 A G 7: 28,288,011 L314P probably damaging Het
Bloc1s1 T A 10: 128,923,398 R43* probably null Het
Blvra A C 2: 127,092,062 I125L probably benign Het
Caps2 T C 10: 112,208,347 F484L probably damaging Het
Car9 A G 4: 43,509,002 N228S noncoding transcript Het
Ccp110 T C 7: 118,722,782 Y390H not run Het
Cep76 A T 18: 67,634,898 I188K possibly damaging Het
Cidea T A 18: 67,367,428 F187I probably benign Het
Cntn3 T A 6: 102,165,331 N1025I probably benign Het
Cntnap3 A T 13: 64,778,862 C565S probably benign Het
Cpne9 T C 6: 113,304,627 S1067P noncoding transcript Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Cyp2d26 C T 15: 82,792,447 probably null Het
Cyp2j12 A T 4: 96,132,993 probably null Het
Dnajb13 T C 7: 100,504,541 N253S noncoding transcript Het
Dpys A G 15: 39,793,402 V423A possibly damaging Het
Eif4e1b A T 13: 54,787,325 I222F probably damaging Het
Eif5b A T 1: 38,018,877 N87Y unknown Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epha7 T A 4: 28,961,425 L890Q probably damaging Het
Fancm T A 12: 65,122,052 S1730T possibly damaging Het
Flrt3 A G 2: 140,661,655 F18L probably benign Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
Gm12715 G A 4: 103,564,347 E316K noncoding transcript Het
H2-M10.4 A G 17: 36,461,982 I36T probably benign Het
Ifi204 C A 1: 173,760,361 L552F noncoding transcript Het
Igfn1 G A 1: 135,967,209 S1873L possibly damaging Het
Ints12 A T 3: 133,096,785 D10V probably damaging Het
Kbtbd2 A G 6: 56,779,303 S483P probably benign Het
Kcnv2 G C 19: 27,323,567 A273P probably damaging Het
Kctd10 C T 5: 114,367,173 G187D noncoding transcript Het
Klc3 T G 7: 19,395,831 D371A probably damaging Het
Lama3 T A 18: 12,578,029 L3173* probably null Het
Ldhal6b G T 17: 5,418,307 H117Q probably damaging Het
Lrriq1 G T 10: 103,215,749 Q381K possibly damaging Het
Mrps31 T A 8: 22,419,738 L140Q probably damaging Het
Mtfr1l A G 4: 134,530,671 S164P noncoding transcript Het
Myo15b A G 11: 115,884,008 T465A probably benign Het
Nkx6-2 T C 7: 139,581,540 D243G probably damaging Het
Nr1h3 G A 2: 91,184,739 R415C noncoding transcript Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Papln C T 12: 83,781,983 T821I probably benign Het
Pds5a T A 5: 65,627,162 I512L noncoding transcript Het
Pitpnb T G 5: 111,371,352 V166G probably benign Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plcxd3 C A 15: 4,375,787 S25R probably benign Het
Ppargc1a T C 5: 51,495,696 I175V possibly damaging Het
Ppp1r13b T A 12: 111,833,281 Q810H probably benign Het
Prpf3 A G 3: 95,834,092 V584A probably damaging Het
Psen2 A G 1: 180,227,724 L399S probably damaging Het
Psmd14 A G 2: 61,722,740 R85G noncoding transcript Het
Ptchd3 G A 11: 121,836,409 V370I probably damaging Het
Rasa3 G T 8: 13,570,394 D758E probably benign Het
Reck T C 4: 43,898,060 C113R probably damaging Het
Rer1 A G 4: 155,074,934 W327R noncoding transcript Het
Ric1 T A 19: 29,598,017 F1009I possibly damaging Het
Rrp12 T C 19: 41,871,536 N1035S probably damaging Het
Rtel1 T A 2: 181,352,169 S849T probably benign Het
Scn10a A T 9: 119,633,791 Y1061N probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Sh2b1 C T 7: 126,468,415 probably null Het
Slc37a2 C T 9: 37,234,457 C233Y noncoding transcript Het
Slc6a16 G A 7: 45,259,156 M42I probably benign Het
Slc7a14 T A 3: 31,230,398 Y263F probably damaging Het
Slco3a1 A G 7: 74,320,567 S431P probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Spopl A T 2: 23,515,297 probably null Het
Stk10 A T 11: 32,555,172 T69S probably benign Het
Suz12 T C 11: 79,995,642 F9S noncoding transcript Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tec G A 5: 72,783,731 P161L possibly damaging Het
Tnip1 A G 11: 54,924,402 S339P probably benign Het
Tnks1bp1 G A 2: 85,050,951 W115* probably null Het
Tsen34 T A 7: 3,700,633 V290D probably damaging Het
Tuba1a T A 15: 98,951,682 I5F possibly damaging Het
Uox T C 3: 146,597,212 I22T noncoding transcript Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn1r63 T C 7: 5,803,517 R39G possibly damaging Het
Xylt2 A G 11: 94,669,529 Y307H possibly damaging Het
Zfp65 A G 13: 67,724,222 M1T probably null Het
Zmym4 T C 4: 126,923,165 I247V probably benign Het
Other mutations in 0610037L13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:0610037L13Rik APN 4 107894868 unclassified 0.00
R0787:0610037L13Rik UTSW 4 107890129 missense probably damaging 1.00
R3500:0610037L13Rik UTSW 4 107891513 missense probably damaging 0.99
R4778:0610037L13Rik UTSW 4 107891998 missense probably damaging 1.00
R5940:0610037L13Rik UTSW 4 107893288 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCTGACATGCAGGAAGGTTG -3'
(R):5'- GCAAGATGGAGAATTCCTATTTCAGTC -3'

Sequencing Primer
(F):5'- GGTTGACCAAGGATCCTCACTC -3'
(R):5'- CAGTCTCTGTAAGAAGCAAAGTTCGC -3'
Posted OnOct 21, 2015