Incidental Mutation 'R4702:2810474O19Rik'
ID356125
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 041950-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4702 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149329403 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1316 (T1316A)
Ref Sequence ENSEMBL: ENSMUSP00000140026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect probably benign
Transcript: ENSMUST00000046689
AA Change: T1316A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: T1316A

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100765
AA Change: T1316A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: T1316A

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect probably benign
Transcript: ENSMUST00000130664
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect probably benign
Transcript: ENSMUST00000189837
AA Change: T1316A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: T1316A

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189932
AA Change: T1316A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: T1316A

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,589 T390A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Adra1a T C 14: 66,637,559 probably benign Het
Aff1 T C 5: 103,811,069 Y343H probably damaging Het
Antxr2 C T 5: 97,949,169 probably null Het
Ap1m2 A G 9: 21,298,295 F362L probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Armc3 A G 2: 19,309,981 N822S probably damaging Het
Atr A C 9: 95,920,355 T1767P possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bloc1s1 T A 10: 128,923,398 Q13L probably damaging Het
Blvra A C 2: 127,092,062 I125L probably benign Het
Caps2 T C 10: 112,208,347 F484L probably damaging Het
Cep76 A T 18: 67,634,898 I188K possibly damaging Het
Cidea T A 18: 67,367,428 F187I probably benign Het
Cntn3 T A 6: 102,165,331 N1025I probably benign Het
Cntnap3 A T 13: 64,778,862 C565S probably benign Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Cyp2d26 C T 15: 82,792,447 probably benign Het
Cyp2j12 A T 4: 96,132,993 probably null Het
Dnajb13 T C 7: 100,504,541 N229S probably benign Het
Dpys A G 15: 39,793,402 V423A possibly damaging Het
Eif4e1b A T 13: 54,787,325 I222F probably damaging Het
Eif5b A T 1: 38,018,877 N87Y unknown Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epha7 T A 4: 28,961,425 L890Q probably damaging Het
Fancm T A 12: 65,122,052 S1730T possibly damaging Het
Flrt3 A G 2: 140,661,655 F18L probably benign Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
H2-M10.4 A G 17: 36,461,982 I36T probably benign Het
Igfn1 G A 1: 135,967,209 S1873L possibly damaging Het
Ints12 A T 3: 133,096,785 D10V probably damaging Het
Kbtbd2 A G 6: 56,779,303 S483P probably benign Het
Kcnv2 G C 19: 27,323,567 A273P probably damaging Het
Klc3 T G 7: 19,395,831 D371A probably damaging Het
Lama3 T A 18: 12,578,029 L1567* probably null Het
Ldhal6b G T 17: 5,418,307 H117Q probably damaging Het
Lrriq1 G T 10: 103,215,749 Q381K possibly damaging Het
Mrps31 T A 8: 22,419,738 L140Q probably damaging Het
Myo15b A G 11: 115,884,008 T2119A probably benign Het
Nkx6-2 T C 7: 139,581,540 D243G probably damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Papln C T 12: 83,781,983 T821I probably benign Het
Pitpnb T G 5: 111,371,352 V166G probably benign Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plcxd3 C A 15: 4,375,787 S25R probably benign Het
Ppargc1a T C 5: 51,495,696 I175V possibly damaging Het
Ppp1r13b T A 12: 111,833,281 Q687H probably benign Het
Prpf3 A G 3: 95,834,092 V584A probably damaging Het
Psen2 A G 1: 180,227,724 L399S probably damaging Het
Ptchd3 G A 11: 121,836,409 V370I probably damaging Het
Rasa3 G T 8: 13,570,394 D758E probably benign Het
Reck T C 4: 43,898,060 C113R probably damaging Het
Ric1 T A 19: 29,598,017 F1009I possibly damaging Het
Rrp12 T C 19: 41,871,536 N1035S probably damaging Het
Rtel1 T A 2: 181,352,169 S849T probably benign Het
Scn10a A T 9: 119,633,791 Y1060N possibly damaging Het
Selenov A G 7: 28,288,011 L314P probably damaging Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc7a14 T A 3: 31,230,398 Y263F probably damaging Het
Slco3a1 A G 7: 74,320,567 S431P probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Spopl A T 2: 23,515,297 probably null Het
Stk10 A T 11: 32,555,172 T69S probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tec G A 5: 72,783,731 P161L possibly damaging Het
Tnip1 A G 11: 54,924,402 S339P probably benign Het
Tsen34 T A 7: 3,700,633 V290D probably damaging Het
Tuba1a T A 15: 98,951,682 I5F possibly damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn1r63 T C 7: 5,803,517 R39G possibly damaging Het
Xylt2 A G 11: 94,669,529 Y307H possibly damaging Het
Zfp65 A G 13: 67,724,222 M1T probably null Het
Zmym4 T C 4: 126,923,165 I247V probably benign Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCAGGAATATTTACAACGGC -3'
(R):5'- CCGTTCTGTGCATTTAAACGC -3'

Sequencing Primer
(F):5'- GCTTCCAGAAACATCTGTGTAG -3'
(R):5'- CTGTGCATTTAAACGCAACTCG -3'
Posted On2015-10-21