Incidental Mutation 'R4702:Myo15b'
ID356153
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 041950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4702 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115884008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2119 (T2119A)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably benign
Transcript: ENSMUST00000040703
AA Change: T465A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427
AA Change: T465A

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093911
AA Change: T2119A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: T2119A

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125835
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151507
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
AA Change: T697A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,329,403 T1316A probably benign Het
4921509C19Rik T C 2: 151,472,589 T390A probably benign Het
Adam25 G T 8: 40,754,126 C143F probably damaging Het
Adra1a T C 14: 66,637,559 probably benign Het
Aff1 T C 5: 103,811,069 Y343H probably damaging Het
Antxr2 C T 5: 97,949,169 probably null Het
Ap1m2 A G 9: 21,298,295 F362L probably benign Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Armc3 A G 2: 19,309,981 N822S probably damaging Het
Atr A C 9: 95,920,355 T1767P possibly damaging Het
B4galnt1 G T 10: 127,167,525 V172F possibly damaging Het
Bloc1s1 T A 10: 128,923,398 Q13L probably damaging Het
Blvra A C 2: 127,092,062 I125L probably benign Het
Caps2 T C 10: 112,208,347 F484L probably damaging Het
Cep76 A T 18: 67,634,898 I188K possibly damaging Het
Cidea T A 18: 67,367,428 F187I probably benign Het
Cntn3 T A 6: 102,165,331 N1025I probably benign Het
Cntnap3 A T 13: 64,778,862 C565S probably benign Het
Cyp2d22 A C 15: 82,375,917 L22R probably damaging Het
Cyp2d26 C T 15: 82,792,447 probably benign Het
Cyp2j12 A T 4: 96,132,993 probably null Het
Dnajb13 T C 7: 100,504,541 N229S probably benign Het
Dpys A G 15: 39,793,402 V423A possibly damaging Het
Eif4e1b A T 13: 54,787,325 I222F probably damaging Het
Eif5b A T 1: 38,018,877 N87Y unknown Het
Enam T A 5: 88,503,791 L1053* probably null Het
Epha7 T A 4: 28,961,425 L890Q probably damaging Het
Fancm T A 12: 65,122,052 S1730T possibly damaging Het
Flrt3 A G 2: 140,661,655 F18L probably benign Het
Git2 A G 5: 114,745,482 S396P probably damaging Het
H2-M10.4 A G 17: 36,461,982 I36T probably benign Het
Igfn1 G A 1: 135,967,209 S1873L possibly damaging Het
Ints12 A T 3: 133,096,785 D10V probably damaging Het
Kbtbd2 A G 6: 56,779,303 S483P probably benign Het
Kcnv2 G C 19: 27,323,567 A273P probably damaging Het
Klc3 T G 7: 19,395,831 D371A probably damaging Het
Lama3 T A 18: 12,578,029 L1567* probably null Het
Ldhal6b G T 17: 5,418,307 H117Q probably damaging Het
Lrriq1 G T 10: 103,215,749 Q381K possibly damaging Het
Mrps31 T A 8: 22,419,738 L140Q probably damaging Het
Nkx6-2 T C 7: 139,581,540 D243G probably damaging Het
Olfr374 T A 8: 72,110,200 F211L probably damaging Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Papln C T 12: 83,781,983 T821I probably benign Het
Pitpnb T G 5: 111,371,352 V166G probably benign Het
Pla2g15 T A 8: 106,163,059 M321K probably benign Het
Plcxd3 C A 15: 4,375,787 S25R probably benign Het
Ppargc1a T C 5: 51,495,696 I175V possibly damaging Het
Ppp1r13b T A 12: 111,833,281 Q687H probably benign Het
Prpf3 A G 3: 95,834,092 V584A probably damaging Het
Psen2 A G 1: 180,227,724 L399S probably damaging Het
Ptchd3 G A 11: 121,836,409 V370I probably damaging Het
Rasa3 G T 8: 13,570,394 D758E probably benign Het
Reck T C 4: 43,898,060 C113R probably damaging Het
Ric1 T A 19: 29,598,017 F1009I possibly damaging Het
Rrp12 T C 19: 41,871,536 N1035S probably damaging Het
Rtel1 T A 2: 181,352,169 S849T probably benign Het
Scn10a A T 9: 119,633,791 Y1060N possibly damaging Het
Selenov A G 7: 28,288,011 L314P probably damaging Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Slc7a14 T A 3: 31,230,398 Y263F probably damaging Het
Slco3a1 A G 7: 74,320,567 S431P probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Spopl A T 2: 23,515,297 probably null Het
Stk10 A T 11: 32,555,172 T69S probably benign Het
Tbxas1 T C 6: 39,083,857 probably null Het
Tec G A 5: 72,783,731 P161L possibly damaging Het
Tnip1 A G 11: 54,924,402 S339P probably benign Het
Tsen34 T A 7: 3,700,633 V290D probably damaging Het
Tuba1a T A 15: 98,951,682 I5F possibly damaging Het
Vmn1r31 C A 6: 58,471,968 *304L probably null Het
Vmn1r63 T C 7: 5,803,517 R39G possibly damaging Het
Xylt2 A G 11: 94,669,529 Y307H possibly damaging Het
Zfp65 A G 13: 67,724,222 M1T probably null Het
Zmym4 T C 4: 126,923,165 I247V probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGAAATCCGAAACATCATCCGAATG -3'
(R):5'- GCCTTAGGTCGAGGAACTACAG -3'

Sequencing Primer
(F):5'- GAATGTACCAGAGCCGTCCAG -3'
(R):5'- TTAGGCGATGTCTGCAAGAGC -3'
Posted On2015-10-21