Incidental Mutation 'R4702:Tuba1a'
ID 356165
Institutional Source Beutler Lab
Gene Symbol Tuba1a
Ensembl Gene ENSMUSG00000072235
Gene Name tubulin, alpha 1A
Synonyms Talpha1 alpha-tubulin, Tuba-1, Tuba1
MMRRC Submission 041950-MU
Accession Numbers
Essential gene? Not available question?
Stock # R4702 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 98847728-98851382 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98849563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 5 (I5F)
Ref Sequence ENSEMBL: ENSMUSP00000094778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097014] [ENSMUST00000134214]
AlphaFold P68369
Predicted Effect possibly damaging
Transcript: ENSMUST00000097014
AA Change: I5F

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094778
Gene: ENSMUSG00000072235
AA Change: I5F

DomainStartEndE-ValueType
Tubulin 49 246 1.72e-82 SMART
Tubulin_C 248 393 1.19e-58 SMART
low complexity region 433 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134214
AA Change: I5F

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136329
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blotting studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, mental retardation, and early-onset epilepsy and caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Heterozygous mutation of this gene results in hyperactivity, reduced anxiety, impaired spatial working memory, and abnormalities in the laminar architecture of the hippocampus and cortex, accompanied by impaired neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,314,509 (GRCm39) T390A probably benign Het
Adam25 G T 8: 41,207,163 (GRCm39) C143F probably damaging Het
Adra1a T C 14: 66,875,008 (GRCm39) probably benign Het
Aff1 T C 5: 103,958,935 (GRCm39) Y343H probably damaging Het
Antxr2 C T 5: 98,097,028 (GRCm39) probably null Het
Ap1m2 A G 9: 21,209,591 (GRCm39) F362L probably benign Het
Apobec4 A G 1: 152,632,001 (GRCm39) T10A probably benign Het
Armc3 A G 2: 19,314,792 (GRCm39) N822S probably damaging Het
Atr A C 9: 95,802,408 (GRCm39) T1767P possibly damaging Het
B4galnt1 G T 10: 127,003,394 (GRCm39) V172F possibly damaging Het
Bloc1s1 T A 10: 128,759,267 (GRCm39) Q13L probably damaging Het
Blvra A C 2: 126,933,982 (GRCm39) I125L probably benign Het
Caps2 T C 10: 112,044,252 (GRCm39) F484L probably damaging Het
Cep76 A T 18: 67,767,968 (GRCm39) I188K possibly damaging Het
Cidea T A 18: 67,500,498 (GRCm39) F187I probably benign Het
Cntn3 T A 6: 102,142,292 (GRCm39) N1025I probably benign Het
Cntnap3 A T 13: 64,926,676 (GRCm39) C565S probably benign Het
Cyp2d22 A C 15: 82,260,118 (GRCm39) L22R probably damaging Het
Cyp2d26 C T 15: 82,676,648 (GRCm39) probably benign Het
Cyp2j12 A T 4: 96,021,230 (GRCm39) probably null Het
Dnajb13 T C 7: 100,153,748 (GRCm39) N229S probably benign Het
Dpys A G 15: 39,656,798 (GRCm39) V423A possibly damaging Het
Eif4e1b A T 13: 54,935,138 (GRCm39) I222F probably damaging Het
Eif5b A T 1: 38,057,958 (GRCm39) N87Y unknown Het
Enam T A 5: 88,651,650 (GRCm39) L1053* probably null Het
Epha7 T A 4: 28,961,425 (GRCm39) L890Q probably damaging Het
Fancm T A 12: 65,168,826 (GRCm39) S1730T possibly damaging Het
Flrt3 A G 2: 140,503,575 (GRCm39) F18L probably benign Het
Git2 A G 5: 114,883,543 (GRCm39) S396P probably damaging Het
H2-M10.4 A G 17: 36,772,874 (GRCm39) I36T probably benign Het
Igfn1 G A 1: 135,894,947 (GRCm39) S1873L possibly damaging Het
Ints12 A T 3: 132,802,546 (GRCm39) D10V probably damaging Het
Kbtbd2 A G 6: 56,756,288 (GRCm39) S483P probably benign Het
Kcnv2 G C 19: 27,300,967 (GRCm39) A273P probably damaging Het
Klc3 T G 7: 19,129,756 (GRCm39) D371A probably damaging Het
Lama3 T A 18: 12,711,086 (GRCm39) L1567* probably null Het
Ldhal6b G T 17: 5,468,582 (GRCm39) H117Q probably damaging Het
Lrriq1 G T 10: 103,051,610 (GRCm39) Q381K possibly damaging Het
Mrps31 T A 8: 22,909,754 (GRCm39) L140Q probably damaging Het
Myo15b A G 11: 115,774,834 (GRCm39) T2119A probably benign Het
Nkx6-2 T C 7: 139,161,456 (GRCm39) D243G probably damaging Het
Or1ab2 T A 8: 72,864,044 (GRCm39) F211L probably damaging Het
Or8b3b A T 9: 38,584,776 (GRCm39) M1K probably null Het
Papln C T 12: 83,828,757 (GRCm39) T821I probably benign Het
Pitpnb T G 5: 111,519,218 (GRCm39) V166G probably benign Het
Pla2g15 T A 8: 106,889,691 (GRCm39) M321K probably benign Het
Plcxd3 C A 15: 4,405,269 (GRCm39) S25R probably benign Het
Ppargc1a T C 5: 51,653,038 (GRCm39) I175V possibly damaging Het
Ppp1r13b T A 12: 111,799,715 (GRCm39) Q687H probably benign Het
Prpf3 A G 3: 95,741,404 (GRCm39) V584A probably damaging Het
Psen2 A G 1: 180,055,289 (GRCm39) L399S probably damaging Het
Ptchd3 G A 11: 121,727,235 (GRCm39) V370I probably damaging Het
Rasa3 G T 8: 13,620,394 (GRCm39) D758E probably benign Het
Reck T C 4: 43,898,060 (GRCm39) C113R probably damaging Het
Resf1 A G 6: 149,230,901 (GRCm39) T1316A probably benign Het
Ric1 T A 19: 29,575,417 (GRCm39) F1009I possibly damaging Het
Rrp12 T C 19: 41,859,975 (GRCm39) N1035S probably damaging Het
Rtel1 T A 2: 180,993,962 (GRCm39) S849T probably benign Het
Scn10a A T 9: 119,462,857 (GRCm39) Y1060N possibly damaging Het
Selenov A G 7: 27,987,436 (GRCm39) L314P probably damaging Het
Selplg T C 5: 113,957,094 (GRCm39) D404G probably benign Het
Slc7a14 T A 3: 31,284,547 (GRCm39) Y263F probably damaging Het
Slco3a1 A G 7: 73,970,315 (GRCm39) S431P probably damaging Het
Speer3 C G 5: 13,846,394 (GRCm39) A238G possibly damaging Het
Spopl A T 2: 23,405,309 (GRCm39) probably null Het
Stk10 A T 11: 32,505,172 (GRCm39) T69S probably benign Het
Tbxas1 T C 6: 39,060,791 (GRCm39) probably null Het
Tec G A 5: 72,941,074 (GRCm39) P161L possibly damaging Het
Tnip1 A G 11: 54,815,228 (GRCm39) S339P probably benign Het
Tsen34 T A 7: 3,703,632 (GRCm39) V290D probably damaging Het
Vmn1r31 C A 6: 58,448,953 (GRCm39) *304L probably null Het
Vmn1r63 T C 7: 5,806,516 (GRCm39) R39G possibly damaging Het
Xylt2 A G 11: 94,560,355 (GRCm39) Y307H possibly damaging Het
Zfp65 A G 13: 67,872,341 (GRCm39) M1T probably null Het
Zmym4 T C 4: 126,816,958 (GRCm39) I247V probably benign Het
Other mutations in Tuba1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6307:Tuba1a UTSW 15 98,849,410 (GRCm39) missense probably benign 0.01
R7127:Tuba1a UTSW 15 98,849,455 (GRCm39) missense probably benign
R8082:Tuba1a UTSW 15 98,848,742 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTCCAGGTCTACGAACACTG -3'
(R):5'- TAGGCCACACCCACTTTTGG -3'

Sequencing Primer
(F):5'- TCTACGAACACTGCCCGG -3'
(R):5'- ACACCCACTTTTGGTGTTTGTAG -3'
Posted On 2015-10-21